Включение отопления нормы: график и при какой температуре происходит включение и отключение

Содержание

в России нельзя включать батареи раньше

В Госдуме предложили изменить общероссийские правила включения центрального отопления. Чтобы люди не мерзли в своих квартирах, давать тепло хотят уже после трех дней при 10 градусах за окном. Но старый принцип основан на расчетах и исследованиях, а новый ничем не обоснован. Значительно лучше целиком сменить принцип теплоснабжения в домах — но на это уйдет много времени и денег.

Поднять градус?

Депутат Госдумы от «Единой России» Елена Вторыгина предложила изменить отопительную норму. По ее мнению, нужно начать давать тепло людям, когда температура на улице три дня держится на уровне 10 градусов, а не после пяти дней при восьми градусах, как это делается сейчас.

Пока предложение парламентария большой поддержки не вызвало. Наоборот, многие эксперты нашли существенные недостатки в такой идее. Главный из них — необдуманность предлагаемых изменений. Создатель и руководитель проекта «Дом-и-двор.РФ», эксперт ЖКХ Павел Степура объяснил «360», что действующие нормы устанавливались давно и основывались на практике.

«Если реально более пяти дней устойчивая температура ниже восьми градусов, тогда вопрос понятен, что есть смысл включать отопление», — сказал он.

На чем основывается нынешнее предложение депутата Вторыгиной, не вполне понятно. Более того, если температура в 10 градусов будет держаться три дня, отопление включат, а потом снова потеплеет — например, придет бабье лето, — придется снова все отключать. Иначе люди зажарятся в квартирах при теплой погоде и включенных батареях.

К сожалению, нельзя без особых последствий включить отопление, потом выключить, когда потеплеет, а потом снова включить. Потому что каждый раз отключать систему — это крайне тяжело для самой системы и приведет к техническим проблемам

Павел Степура.

Чтобы поменять существующую норму с пяти дней на три и с восьми градусов на 10, нужно серьезное обоснование, уверен эксперт. Для этого нужно сделать расчеты, провести исследования и четко описать необходимость нововведений.

«А пока это просто предложение, которое ни на чем не основано», — заключил Степура.

Как решить проблему с теплом

Однако выход из ситуации все же есть. Понравиться он может далеко не всем, да и о реальности его воплощения в жизнь в условиях городов еще предстоит подумать. По словам Степуры, есть варианты, при которых в домах на крыше делают газовые котельные, которые работают как замена централизованного теплоснабжения.

Такие котельные можно включить по решению собственников квартир в доме или, например, управляющей компании в любой момент, когда жильцы сочтут это необходимым.

«Это прекрасное решение: в таких домах по решению собственников отопление можно включить тогда, когда они сами захотят. Эта схема распространена практически во всех странах, кроме России, и во многих домах индивидуального жилищного строительства», — отметил Степура.

Директор управляющей компании и эксперт по развитию ЖКХ Юрий Подобед добавил, что в домах иногда ставят индивидуальные тепловые станции, которые можно включить по желанию жильцов, когда большинству становится холодно.

«Во многих особенно ветхих домах городского фонда теплоемкость достаточно изношена. И при существенном снижении температуры жильцам приходится прибегать к дополнительным отопительным приборам», — отметил Подобед.

В подобных условиях более гибкая система индивидуального теплоснабжения отдельных домов или кварталов, по его мнению, была бы уместнее. В Европе, например, чаще всего используется именно такая схема отопления.

«Любой дом — это индивидуальное строение, нормативы должны быть более гибкими и отданы в управление жильцам или управляющим компаниям. То есть стало холодно — включили, стало жарко — выключили», — подытожил эксперт.

Однако пока в России значительная часть городов подключена к центральному отоплению, которое для всех включается единовременно по установленной схеме. Переводить огромные территории жилого фонда на новые отопительных схемы затруднительно — и из-за денег, и из-за инфраструктуры.

Мособлдума: изменение норм отопления не увеличит нагрузку энергокомпаний

https://realty. ria.ru/20210910/otoplenie-1749483840.html

Мособлдума: изменение норм отопления не увеличит нагрузку энергокомпаний

Мособлдума: изменение норм отопления не увеличит нагрузку энергокомпаний — Недвижимость РИА Новости, 21.09.2021

Мособлдума: изменение норм отопления не увеличит нагрузку энергокомпаний

Изменение норм включения отопления в России не увеличит нагрузку на ресурсоснабжающие организации, считает председатель комитета Мособлдумы по вопросам… Недвижимость РИА Новости, 21.09.2021

2021-09-10T11:33

2021-09-10T11:33

2021-09-21T17:59

происшествия

ногинск

московская областная дума

жкх

отопление

елена вторыгина

россия

взрыв газа в жилом доме в ногинске

/html/head/meta[@name=’og:title’]/@content

/html/head/meta[@name=’og:description’]/@content

https://cdnn21.img.ria.ru/images/07e4/0a/10/1580157268_0:0:3008:1692_1920x0_80_0_0_2982e8fd1df7fa517d62016931183cf2.jpg

МОСКВА, 10 сен – РИА Недвижимость. Изменение норм включения отопления в России не увеличит нагрузку на ресурсоснабжающие организации, считает председатель комитета Мособлдумы по вопросам строительства, архитектуры, ЖКХ и энергетики Игорь Коханый.Ранее депутат Госдумы от «Единой России» Елена Вторыгина на фоне трагедии со взрывом газа в жилом доме в подмосковном Ногинске обратилась к премьер-министру России Михаилу Мишустину с предложением изменить условия включения центрального отопления в домах. В частности, она предложила включать его при предельной среднесуточной температуре десять градусов Цельсия, а не восемь, которая держится три дня, а не пять.Он также добавил, что принятие новых норм позволило бы не только избежать трагичных ситуаций, как это было в подмосковном Ногинске, но и снизить количество пожаров от некачественных электрообогревателей.»Еще одним плюсом может стать экономия граждан на электроэнергии. Включение отопления при температуре десять градусов в расчетном листке может выйти дешевле, чем дополнительные расходы на постоянно работающий обогреватель», — сказал депутат. В Ногинске 8 сентября в жилом доме произошел взрыв бытового газа. Предварительно, обрушились второй и третий этажи здания и частично четвертый этаж. Были эвакуированы более 170 человек. По последним данным МЧС, погибли семь человек, 15 пострадали. Как сообщили некоторые СМИ со ссылкой на источник в силовых структурах, жильцы дома предположительно оставили газовую плиту включенной на ночь для обогрева квартиры.

ногинск

россия

Недвижимость РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2021

Недвижимость РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://realty.ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

Недвижимость РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og. xn--p1ai/awards/

https://cdnn21.img.ria.ru/images/07e4/0a/10/1580157268_0:0:2732:2048_1920x0_80_0_0_4bf2f19760d0615db8d1d8f843ead3ad.jpg

Недвижимость РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Недвижимость РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

происшествия, ногинск, московская областная дума, жкх, отопление, елена вторыгина, россия, взрыв газа в жилом доме в ногинске

11:33 10.09.2021 (обновлено: 17:59 21.09.2021)

Мособлдума: изменение норм отопления не увеличит нагрузку энергокомпаний

Можно ли коллективно написать заявление в УК, чтобы отопление дали раньше? | ЖКХ | Недвижимость

Подача тепла в многоквартирные дома начинается, когда среднесуточная температура в течение пяти дней держится на уровне не выше восьми градусов. Такие нормы определены постановлением Правительства РФ от 6 мая 2011 г. N 354 «О предоставлении коммунальных услуг собственникам и пользователям помещений в многоквартирных домах и жилых домов».

Как сделать так, чтобы тепло включили раньше намеченного срока?

Включить отопление дома раньше можно, если на общедомовом собрании жильцов собрать подписи за досрочное включение. При этом собственники квартир должны учитывать, что более ранний пуск отопления повлияет на стоимость и объем потребления: чем раньше включат отопление, тем больше придется платить.

После сбора подписей необходимо направить в управляющую компанию или теплоснабжающую организацию, если договор заключен напрямую, заявку на досрочное включение отопления. При этом должны соблюдаться несколько условий:

  • дом должен быть полностью готов к началу отопительного сезона, исправны все трубы, проведены испытания;
  • должна быть техническая возможность включить отопление только в этом доме;
  • дом должен быть оборудован общедомовым счетчиком тепла.

Сколько голосов жильцов необходимо собрать?

Для принятия решения необходимо, чтобы 2/3 жильцов выступили за него. Протокол нужно передать управляющей компании, которая, в свою очередь, будет его согласовывать с тепловиками.

В каких случаях могут отказать и не включить отопление раньше срока?

Ресурсоснабжающая компания может отказать в более раннем пуске отопления, если жильцы дома имеют долги за услуги теплоснабжения.

Кому отопление включают в первую очередь?

С началом отопительного сезона в первую очередь отопление включают в детских садах, школах, больницах. Затем подключают жилой фонд, многоквартирные дома, социальные учреждения и т. д.

Почему нельзя подать отопление за один день?

По регламенту пуск тепла в дома рассчитан на пять дней. Процесс подачи теплоносителя должен проходить плавно, в порядке подключения потребителей, чтобы соблюсти все гидравлические параметры (давление) в распределительных сетях. Если технологические нормы не будут соблюдены, в системе отопления возможны аварии и сбои. Как включение, так и выключение отопления может длиться до 5 дней. Выключают тепло, когда среднесуточная температура в течение пяти дней подряд держится выше восьми градусов Цельсия. При этом, если отопительный сезон наступил и после него пришло бабье лето, теплоснабжение полностью не отключают.

Куда обращаться, если отопительный сезон начался, а отопление в квартире отсутствует?

Если вам вовремя не включили отопление, нужно обращаться в управляющую или ресурсоснабжащую компанию.

В Москве в случае проблем с отоплением можно обращаться по телефонам:

  • 8-800-100-23-29 — горячая линия по вопросам отключения отопления;
  • +7 (495) 539-59-59 — круглосуточная горячая линия МОЭК для потребителей.

Также можно оставить заявку через мобильное приложение «Госуслуги Москвы».

принятие решения, процесс включения отопления, подача жалобы и нюансы процедуры

Главная/Правила отопления/Начало отопительного сезона

Каждую осень перед началом отопительного сезона жильцы многоэтажек испытывают дискомфорт, поскольку в квартирах становится прохладно. Возникают подозрения по поводу того, что коммунальщики затягивают сроки, желая сэкономить. В действительности управляющие компании не могут включать отопление по своему усмотрению – существует регламент, устанавливающий сроки и порядок этой процедуры. Еще один момент: перед запуском системы ее нужно протестировать и отремонтировать – нередко возникают протечки и воздушные пробки. Нужно время на устранение этих неполадок, чтобы не было проблем зимой.

Внимание

Решение о включении отопления принимают органы местного самоуправления, а не УК и ТСН. Точной даты не установлено, закон требует ориентироваться по погоде. Отопительный сезон должен начаться, если в течение 5 дней среднесуточная температура держится на уровне ниже 8 градусов. При затягивании подачи тепла жильцы вправе жаловаться в организацию, обслуживающую дом, требуя решить проблему и заодно провести перерасчет. При бездействии коммунальщиков можно обращаться в Жилинспекцию, Роспотребнадзор, районную Администрацию.

Нормативная база

Отношения в сфере отопления жилых домов регулирует несколько нормативно-правовых актов:

Внимание! Если у вас возникнут вопросы, можете бесплатно проконсультироваться в чате с юристом внизу экрана или позвонить по телефонам Москва; Санкт-Петербург; Бесплатный звонок для всей России.

  1. Основной закон – ФЗ № 190 от 27.06.2010 г. «О теплоснабжении».
  2. Общие правила теплоснабжения жилых домов установлены в ст. 7 гл. 3 ФЗ № 416 от 07.12.2011 г.
  3. Порядок предоставления коммунальных услуг по отоплению закреплен в Правилах, утвержденных Правительственным Постановлением № 354 от 06.05.2011 г.
  4. В САНПиН 2.1.2.1002-00 прописаны допустимые температуры в квартирах в холодный и теплый сезон.

Какая рекомендуемая норма температуры в квартире?

Нормы температур в жилых помещениях разработаны и закреплены законодательно. В САНПиН 2.1.2.1002-00 указаны точные пределы допустимых температур в квартирах на холодный и теплый сезоны.

Соблюдение этих пределов общеобязательно для всех обслуживающих жилые помещения компаний. Поддержание допустимой, а еще лучше оптимальной температуры в помещении постоянного проживания – залог здоровья и хорошего самочувствия.

В САНПиН 2.1.2.1002-00нормы температур составляют:

Если настало теплое время года:

  • для комнат допускается температурный режим в рамках от 20 до 28 ºС.

В холодное время года:

  • на кухне, в туалете, ванной комнате допускается от 18 до 26 ºС;
  • для комнаты 18-24 ºС.

Кроме допустимой, определяются рамки оптимальной температуры. Отличие этих двух понятий в том, что допустимая температура – это та, границы которой считаются приемлемыми и не противоречащими правилам подачи отопления. Оптимальная же температура является параметром, близким к идеальному, для здоровья человека.

Поэтому рекомендуется жильцам сделать все от них возможное для поддержания оптимальной температуры:

  • утеплять квартиру, если это необходимо для повышения температуры;
  • проветривать, если температура слишком высокая.

Оптимальная температура для комнаты в квартире 22-25 ºС в теплое время, 20-22 ºС – в холодное. На кухне и в туалете оптимальное значение составляет 19-21 ºС. На эти показатели следует равняться для определения соответствия нормам температуры в квартирах.

Когда включают отопление?


В Правительственном Постановлении №354 прописаны условия для начала отопительного сезона. Всего их 2: первое – среднесуточная температура на улице должна опуститься ниже +8 градусов, второе – это значение должно продержаться 5 дней. Таким образом, даже если 4 дня держится аномально низкая температура, но на пятый день обещают потепление, включение отопления наверняка перенесут.
Определенных дат в законе нет. Однако по факту период начала отопительного сезона приходится на сентябрь-октябрь в зависимости от региона страны.

Отопление по договору

Редки случаи, когда жильцы одного дома договариваются о конкретных сроках отопительного сезона с компанией, отвечающей за подачу тепла в их дом. В этом случае заключается договор между жильцами и компанией, в котором прописываются даты начала и окончания подачи тепла в дом. В этом случае среднесуточная температура воздуха роли не играет. Если в договоре предполагается подача тепла, к примеру, 5 октября, то в этот день и будет растоплена котельная для доставки горячей воды в трубы жильцов. И никого не волнует, если на улице будет +15 градусов тепла.

Впрочем, при составлении подобных договоров всегда исходят из здравого смысла и устанавливают реальные даты, когда предположительно начинается похолодание.

Ход включения отопления

В первую очередь отопление подают в здания социального назначения – в поликлиники, детские сады, школы. Затем подключают жилые дома. Отопление запускают постепенно, весь процесс растягивается на 2 недели. Это связано с инертностью системы: необходимо заполнить трубы, подводящие тепло к каждому дому, а это тонны воды, требующие предварительного нагрева до определенной температуры.

Дополнительная информация

Если резко включить отопление по всему городу, нагрузка мгновенно и очень сильно возрастет. В результате ухудшится циркуляция. Также зачастую возникают непредвиденные ситуации, несмотря на длительную подготовку системы. В одном месте обнаруживается трещина в запорной арматуре, в другой – проблемы с клапаном. В связи с этим сантехники после запуска проводят тщательную проверку.

Как осуществляется осмотр систем

До наступления осени во всех точках страны должны завершиться подготовительные работы. С середины сентября работники пробуют подключить отопление в конкретные помещения. Если в случае проверки будут обнаружены какие-то неисправности, будут проводиться дополнительные работы.

Уже после устранения дефектов оформляются документы, разрешающие подключить отопление и к другим домам. Всем компаниям, осуществляющим передачу тепла, выдаются специальные паспорта. Такая подготовка должна закончиться раньше 1 ноября.

Как узнать точную дату начала отопительного сезона?

Постановление районной или муниципальной администрации об утверждении графика подачи отопления публикуется в сети в открытом доступе. Этот документ можно найти на сайте муниципалитета. Также постановление публикуют в городской газете – официальном органе местной власти. Другие СМИ не обязаны выкладывать полный текст, но информацию о сроках отопительного сезона они всегда сообщают. Пока официальный документ не будет обнародован, узнать дату подачи тепла не получится даже при личном обращении в теплоснабжающую организацию или УК.

Действия, если не включают отопление, а уже холодно

Внимание
Если отопительный сезон уже начался, первым делом нужно удостовериться, что все батареи в квартире работают исправно. Если холодно только у вас дома, а у соседей сверху и снизу тепло, проблема может быть в воздушной пробке. Сантехники ее быстро устранят.

Важное значение играет температура в квартире. Согласно нормам СанПин, в жилом помещении должно быть минимум +18 градусов, в угловой комнате +20 градусов. Если температура у вас дома ниже, нужно позвонить в аварийно-диспетчерскую службу и оставить заявку на решение проблемы с отоплением. В течение одного-двух дней причину неисправности обязаны найти и устранить, а также уведомить вас об этом.

Еще нужно требовать, чтобы пришел представитель УК, зафиксировал факт неработающих батарей и низкой температуры. Составленный акт станет основанием для перерасчета стоимости отопления и послужит доказательством, которое при необходимости можно будет приложить к жалобе.

Предварительные работы

Зима наступает каждый год, но для коммунальщиков это всегда неожиданность. В соответствии с ПП №354 управляющая компания и РСО должны проводить профилактические работы инженерных сетей до начала отопительного сезона.

Начало и конец отопительного сезона

Начало периода для подачи теплоснабжения в квартиры зависит от субъекта Российской Федерации. Включить ресурс в дома нужно согласно закону с 1 по 15 октября. Завершение отопительных работ приходится на первые числа апреля до середины мая.

Правила

Согласно закону, руководство местного муниципалитета должно согласовать сроки начала и окончания периода подачи тепла с вышестоящими органами. При этом средняя температура, при которой включают отопление, составляет +8°С.

ТЭЦ и коммунальными службами отвечают за поддержание необходимого уровня ресурса в жилых квартирах. В таблице приведены нормативы:

Таблица 2.

Вид отапливаемого помещенияНорма, ниже которой не должна опускаться температура внутри объекта недвижимости.Условие – помещение теплоизолировано.

Рекомендуем: Как сделать бетон своими руками — пошаговая инструкция

Квартира в МКД, частный дом18-20 °С. Если на улице ниже -30°С, то показатель увеличивается на 2°
Помещение, в котором работают люди20 °С
Классные комнаты при школах18 °С
Игровые в детских садах22 °С
Спальни в дошкольных учреждениях19 °С
Подъезды, коридоры, лестничные проемы в МКД16 °С

Особенности регионов

В силу того, что Россия занимает большую территорию и находится в нескольких климатических зонах, она простирается далеко на север. Разумеется, погодные условия разные, поэтому окончательное решение по вопросам тепла в конкретном регионе лежит на местном муниципалитете.

К примеру, в этой году, прекратили подачу тепла:

  • в Москве отключили 26.04.2019;
  • Туле – 28.04.2019;
  • Ярославле – 24.04.2019;
  • Твери – 29.04.2019.

Когда можно пожаловаться на позднее включение отопления?


До официального старта отопительного сезона сделать ничего нельзя. Управляющая компания проводит запуск системы в соответствии со сроками, установленными органами местной власти, и не вправе нарушать их. Если сроки включения отопления уже вышли, но дома все еще холодно, нужно позвонить в свою УК или теплоснабжающую организацию и спросить, когда дадут отопление. Если вам не дадут четкого ответа, следует подавать жалобу.

Обогрев в межсезонье

Межсезонье в отопительном плане – время между отключением тепла весной и возвратом подачи горячей воды в трубы осенью. Погода вещь непредсказуемая, поэтому резкое похолодание может произойти и в конце весны. В некоторых регионах заморозки продолжаются вплоть до мая.

Государство не имеет возможности открывать и закрывать заслонки ТЭЦ по желанию людей. Поэтому в обычных условиях приходится прибегать к дополнительным средствам обогрева помещений. Чаще всего используют электрические приборы, реже газовые.

В некоторых частных домах при помощи дровяной печи и буржуек происходит дополнительный обогрев.

Пошаговая инструкция подачи жалобы на позднее включение отопления

Жалоба на позднее включение отопления пишется в свободной форме, унифицированного образца не предусмотрено. Обычно документ составляется следующим образом:

  1. В правом верхнем углу заявитель указывает свои личные данные и наименование организации, в которую подается жалоба. Необходимо оставить номер телефона, по которому с вами могут связаться, чтобы мирно урегулировать вопрос.
  2. Затем подробно описывается возникшая проблема. Следует перечислить меры, которые вы успели принять до составления претензии – куда обращались, с кем разговаривали. Составьте список прилагаемых к жалобе документов, если они есть.
  3. В следующем блоке перечисляются требования. Напишите, что обратитесь в суд, если не будут приняты меры.
  4. Внизу ставится сегодняшняя дата и подпись.

Внимание
Жалобу на позднее включение отопления в квартире составляют в двух экземплярах. Один передается лично в руки уполномоченному сотруднику УК, ТСН или теплоснабжающей организации, если договор заключен с ней напрямую. Второй экземпляр, с отметкой о получении, оставляет у себя заявитель. При отказе в приеме претензии можно направить ее заказным письмом или в электронном виде на сайте организации.

подачи жалобы за позднее включение отопления можно здесь.

Рассмотрение и возможные последствия

Управляющая компания обязана рассмотреть претензию на включение отопления многоквартирного дома в течение 10 дней и принять соответствующие меры. На основании этого акта можно будет потребовать сделать перерасчет платы за отопление за весь период, когда с ним были проблемы. За каждый час несоответствия температуры установленным нормам размер платы за отопление снижается на 0.15 % от ежемесячного платежа. Поэтому УК заинтересована в оперативном налаживании теплоснабжения дома.

Если ситуация не изменится, следует обращаться с жалобой в Роспотребнадзор или прокуратуру. При бездействии ведомств можно подавать иск в суд с требованием обязать УК не только провести перерасчет платы за отопление, но и компенсировать моральный вред. Решение суда исполняется в 95% случаев. Если и это не поможет, жильцам дома стоит провести общее собрание и обсудить вопрос смены УК или организации ТСН. Это будет возможно, если большинство собственников проголосуют за такое решение.

Нюансы

Хотя закон требует, чтобы сроки отопительного сезона определялись местными властями, все же есть возможности отклониться от этой нормы. Если коммуникации в порядке, проверены на протечки и другие неисправности, УК может начать подачу тепла, не выжидая 5 дней со среднесуточной температурой менее +8 градусов. Также это допускается по многочисленным заявкам от жильцов.

Есть еще несколько важных нюансов, связанных с началом отопительного сезона:

  1. Подача отопления позже, чем через 5 дней со среднесуточной температурой ниже +8 градусов, является прямым нарушением законодательства РФ. За это организациям, которые поставляют такую услугу, грозят серьезные штрафы.
  2. Если собственники квартир считают, что отопление включают слишком поздно, они вправе заключить договор с теплоснабжающей организацией. В нем можно прописать точные даты включения и отключения. Тогда отопление будет подаваться в указанные сроки без учета температуры на улице. Однако нужно организовать собрание жильцов и добиться, чтобы большинство жильцов выразило свое согласие в письменной форме. Сделать это бывает непросто.
  3. Если отопление уже включили, но дома все равно холодно, сразу жаловаться не стоит. Систему настраивают, увеличивая давление постепенно. Поэтому для того, чтобы батареи стали горячими, иногда требуется несколько дней.
  4. Запрещено самовольно переваривать трубы или ставить радиаторы с большим количеством секций, чтобы было теплее. Это позволяет сделать температуру дома более комфортной, но может нарушить работу отопительной системы. Пострадают жильцы других квартир – у них станет прохладнее. Поэтому через какое-то время соответствующие службы узнают о таком нарушении. Собственника оштрафуют и все равно обяжут вернуть старые батареи.

КомментарииПоказаны 0 из 0

Жилье в новостройках подорожает по неожиданной причине

Согласно постановлению правительства № 354, а точнее пятому пункту его второй статьи, отопление в России нужно включать, если среднесуточная температура в регионе держится ниже +8 °C в течение пяти дней подряд. И наоборот – отключать его, если за окном теплее этой отметки.

Так что все довольно просто. Если температура выше или ниже восьми градусов, власти выпускают распоряжение – и подачу отопления запускают или прекращают. Но по факту часто бывает, что отопительный сезон чиновники начинают раньше – обычно «по многочисленным просьбам граждан». Кроме того, во многих городах жители платят за отопление круглый год, так что финансовый фактор не должен играть серьезной роли.

А как рассчитывается среднесуточная температура?

Здесь тоже все несложно. Возьмем на примере Москвы. Гидрометцентр или любой погодный центр фиксирует температуру воздуха, которую определили их метеостанции, каждый час в течение суток. Получается 24 показателя за 24 часа. Все показатели затем суммируются, и полученное число делится на 24. То есть если, например, какого-то мая в столице температура колебалась от +4 до +8, что сейчас не редкость, среднее значение будет примерно +6, для этого можно даже не слишком углубляться в расчеты.

Сложно ли запустить систему отопления снова?

В разных регионах по-разному, но моментально этого нельзя сделать практически нигде. В России с ее системами центрального отопления, оставшимися еще с 70-80-х годов прошлого века, кипяток проходит довольно долгий путь, прежде чем достигнет рядовой квартиры. От ТЭЦ он идет в тепловые пункты, там смешивается с холодной водой, разогревает ее, и уже она направляется в тепловые узлы домов, они обычно расположены в подвалах. В этих узлах, как правило, стоят термометры, способные регулировать подаваемую в батареи температуру до нужного уровня. Если их нет – все это делается специалистами вручную. И на каждом этапе требуется время на предварительную проверку сетей, в противном случае протечки или прорывы могут привести к плачевным результатам.

В столице, где теплотрассы регулярно ремонтируют и проверяют, а работа ТЭЦ довольно неплохо автоматизирована, процесс запуска отопления перед зимними холодами обычно занимает до пяти дней. А в Хабаровске, например, вдвое больше. Причем многоквартирные дома обычно последние в очереди, перед ними школы, детсады и больницы.

На эту тему

  • Онищенко предложил вернуть отопление в московские больницы и поликлиники
  • В Московской области возобновили подачу тепла в квартиры
  • Вирусолог рассказал, какие риски ждут москвичей без отопления

С учетом того, что в ряде регионов вроде Москвы и Подмосковья отопительный сезон завершился буквально неделю назад, риски от резкого запуска, безусловно, ниже, чем после летнего простоя, и перезапустить системы можно быстрее. Энергетики Московской области, например, говорят, что им потребовались всего сутки. В Москве, можно предположить, сроки будут не больше.

Стоит ли запускать отопление сейчас?

Если говорить о Москве и исходить из нормы выше/ниже +8°C, то тут ситуация пограничная. С одной стороны, пять дней ниже +8°C в столице если еще не прошли, то вот-вот наберутся, а с другой – уже с понедельника, 25 мая, ожидается серьезное и долгосрочное потепление. Подмосковные власти при этом долго думать не стали и включили отопление 20-го числа.

Между тем каждый день без тепла может ухудшить ситуацию с COVID-19, считают вирусологи.

«Ни для кого не секрет, что во время постоянного переохлаждения человек наиболее восприимчив к вирусам. Сейчас уже начинают выявлять все больше и больше латентных больных коронавирусом. То есть пациентов со скрытой инфекцией. Такое течение болезни обоюдовыгодное, так как у человека возникает так называемый нестерильный иммунитет, а у вируса есть место для обитания, за счет чего он не убивает организм. Сейчас иммунитет латентных пациентов сдерживает вирус, но как только он ослабится, появится симптоматика. А это значит, что и нагрузка на организм будет больше, появляется риск перейти в категорию средних и тяжелых больных», – сказал газете ВЗГЛЯД вирусолог, глава отделения микробиологии латентных инфекций Национального исследовательского центра эпидемиологии и микробиологии имени Гамалеи Виктор Зуев.

Смотрите ещё больше видео на YouTube-канале ВЗГЛЯД

Когда включат отопление в квартирах?

Очень быстро и незаметно для многих белорусов прошло лето нынешнего года. Финансовые неурядицы привели к тому, что для многих наступление осени и похолодания оказалось неожиданным, но сегодня все больше белорусов начинают задаваться вопросом, когда включат отопление в квартирах. Судя по всему, придется запастись терпением, ведь пока погода пока еще не стала действительно осенней. 

 

 

По всей Беларуси владельцы жилой недвижимости начинают постепенно мерзнуть в своих квартирах. Это и неудивительно – на дворе начало октября, и, несмотря на солнечную погоду, все сильнее ощущается холодное дыхание осени. Вот только в министерстве жилищно-коммунального хозяйства говорят о том, что точно неизвестно,

когда включат отопление в квартирах. По словам энергетиков, они полностью готовы к отопительному сезону, все системы проверены и исправны. Ждут они только одного – когда осень вступит в свои права полностью и среднесуточная температура станет не выше 10 градусов по Цельсию.


Пока же в Беларуси синоптики прогнозируют продолжение бабьего лета с его высокой для осени температурой. Энергетики пояснили, что для того чтобы начать включать отопление в квартирах, необходима определенная температура. Около недели подряд она не должна превышать 10 градусов Цельсия, лишь в том случае у коммунальных служб появится право начать полноценный отопительный сезон. По состоянию на начало октября средняя температура по городу Минску составляет 14 градусов, а значит, пока отопительный сезон начинать рано. Причем, относительно теплая погода будет сохраняться в Беларуси и в ближайшее время. Так что пока говорить о начале отопительного сезона не приходится.


Коммунальные службы отметили одну интересную тенденцию. С каждым годом отопительный сезон начинается позже, а заканчивается раньше. Климат в стране постепенно изменяется. Если еще несколько десятилетий назад включать отопление в квартирах начинали еще в конце сентября, то в последние годы это обычно происходит во второй декаде октября. Учитывая нынешнюю теплую осень, не исключено, что тепло в квартирах появится еще позже.


Официально для начала отопительного сезона необходимо, чтобы 5 дней кряду температура за окном не превышала 10 градусов Цельсия. При таких температурных условиях начнут отапливать детские сады и средние школы. Если 5 дней подряд температура не будет превышать 8 градусов Цельсия, то начнут обогревать и все объекты жилой недвижимости. В последнюю очередь начинается отопительный сезон для административных зданий и производственных помещений.


Коммунальщики обещают, что в случае резкого похолодания они не станут ждать положенных 5 дней, а постараются сделать так, чтобы тепло в квартирах стало как можно быстрее. В конце стоит напомнить, что в нынешнем году услуги подогрева воды, в том числе и на нужды отопления, подорожали. Так что белорусам стоит морально подготовиться к тому, что платить за тепло в квартире придется больше, чем годом ранее. 

Отопительный сезон 2021-2022 — когда начнется в Украине

Решение о начале и окончании отопительного сезона принимают городские власти

Отопительный сезон — это период, захватывающий всю зиму и части весны и осени. В это время происходит прогрев помещений при помощи труб центрального отопления, пишет bigmir.net.

Когда начинается отопительный сезон в Украине 2021-2022

Отопительный сезон в Украине начинается в первой половине октября, но важную роль играет и среднесуточная температура. Включение батарей во многом зависит от погоды на улице. Существуют нормы, при которых начинают включать отопления в домах граждан. Надо учитывать, что к этому времени система готова к запуску, но нагреваются батареи не сразу. Существует специальный график запуска домов, благодаря которому удается своевременно решать возникающие проблемы – например, протечки.

Читайте также: Тарифы на газ в Украине: озвучены сезонные цены

Стоит отметить, что решение о начале и окончании отопительного сезона принимают городские власти при соблюдении условий. В частности, если среднесуточная температура воздуха на протяжении трех суток подряд не превышает +8 градусов, то в области стартует отопительный сезон.

depositphotos

Такие нормы зафиксированы в «Правилах оказания услуг по централизованному отоплению, поставке холодной и горячей воды» от 21 июля 2005 года.

Когда официально начинается отопительный сезон в Украине 2021-2022

В Украине было принято, что с 15 октября стартует отопительный сезон, хотя местные власти имеют право начинать подачу тепла по своему усмотрению. Если среднесуточная температура воздуха не превышает 8°С в течение трех суток, то обогрев зданий можно начинать раньше или позже указанной даты.

Стоит отметить, что в Министерстве развития общин и территорий Украины сообщают, что состояние подготовки регионов к отопительному сезону на сегодняшний день составляет около 80%. Речь идет о состоянии зданий, объектов водоснабжения и водопроводно-канализационного хозяйства.

Читайте также: Названы регионы Украины с самыми высокими тарифами и ценами на еду

Отмечается, что в Минрегионе постоянно проводится мониторинг готовности, и осуществляются визиты непосредственно в регионы.

depositphotos

Отмечается, что теплокоммунэнерго страны испытывают проблемы, из-за которых не смогут вовремя начать отопительный сезон. У небольших и средних объединенных территориальных громадах и органах местного самоуправления нет достаточно средств: ни на ремонт сетевой инфраструктуры, ни на предоплату за газ.

К слову, эксперты прогнозируют, что  в большинстве таких «проблемных» ТКЭ отопительный сезон стартует не раньше середины ноября.

Тарифы на отопление в Украине в 2021 году

Органы местного самоуправления в Украине имеют полномочия самостоятельно принимать решение, когда начинать и заканчивать отопительный сезон и устанавливать тарифы.

depositphotos

При этом отмечается, что в Украине низкие запасы газа в подземных хранилищах (ПХГ). Так, объемы на начало сентября составляют 18,2 млрд кубометров, что почти на 30% меньше прошлогодних показателей.

Читайте также: Тарифы на электроэнергию в Украине снизят: Кабмин обнародовал постановление

Нехватка запасов может негативно сказаться на потребителях. В частности, дефицит может отразиться на тарифах.

В Минрегионе отмечают, что тарифы для населения сейчас повышаться не должны. Однако полномочия по установлению тарифов на тепло в новом отопительном сезоне предоставлены органам местного самоуправления.

depositphotos

В свою очередь, газопоставляющие компании предлагают населению равномерно платить за потребленное топливо в течение года.

В частности, компания «Нафтогаз Украины» предложила цену 7,96 грн за куб. м. Срок действия тарифа — с 1 октября 2021 по 30 апреля 2022 года. Подключиться к предложению можно до 31 октября.

Читайте также: Тарифы на электроэнергию в Украине снизят: Кабмин обнародовал постановление

Региональные газсбыты предложили цену 7,99 грн за кубометр. Срок действия — с 1 мая 2021 по 30 апреля 2022 года. При этом подключиться к тарифу можно было до 31 августа.

Кроме того, жители Киева в июле текущего года получили счета за коммунальные услуги за июнь, в которых содержалась отдельная строка с рекомендованным авансовым платежом за отопление. Авансовый платеж будет отображаться в лицевых счетах клиентов как переплата.

Предполагается, что таким образом киевляне, оплатив отопление авансом, будут меньше платить за него зимой, у них не будет долгов и, соответственно, не будет штрафных санкций за просрочку оплаты.

depositphotos

Ранее мы писали, что поставщик «последней надежды» повысил  цену на газ для населения. В частности, компания «Нафтогаз Украины» установила на август цену на газ для потребителей, получающих топливо от поставщика «последней надежды», на уровне 11,78 грн за кубометр.

Читайте нас в Google.News

В Воронеже отопление во всех многоквартирных домах начнут постепенно включать с 27 сентября 2021 года

Соответствующее постановление подписал мэр Вадим Кстенин

Подготовка к отопительному сезону продолжается.

Автор: Олег Петров. Фото: из архива.

Сегодня градоначальник подписал постановление о пуске с 27 сентября отопления в жилых домах, а также на всех других объектах в Воронеже.

Как отметили в Гидрометцентре, в нашем городе температура установилась ниже климатической нормы на 1-5 градусов с 16 сентября текущего года. Она будет сохранятся до среды, а затем временно станет теплее, но при этом в ночное время будет достаточно холодно. В некоторые дни – от 2 до 7 градусов тепла. То есть потепления синоптики уже не ожидают.

«В Воронеже сейчас непростая эпидобстановка по коронавирусу, растет заболеваемость гриппом и ОРВИ, – отметил Вадим Кстениин. – В условиях плохой погоды считаю необходимым начинать отопительный период досрочно».

Глава города добавил, что, по его мнению, в этом году пуск тепла будет непростым.

«Во-первых, из-за непривычно ранних сроков, во вторых, из-за низких темпов подготовки домов, которые управляющие компании показывали летом. Информация о нарушителях сроков направлена в ГЖИ и прокуратуру для принятия мер воздействия. Управление ЖКХ и управы районов по моему поручению держали ситуацию на постоянном контроле, в результате сейчас многие подтянулись, однако определенные проблемы неизбежно будут возникать», — пояснил Вадим Кстенин.

В УК «ПИК-Комфорт» сегодня сообщили о том, что их управляющие компании готовы почти на 100%. В домах провели полный комплекс работ.

«В девяти домах в Воронеже подрядчик ФКР либо завершает работы по замене систем отопления, либо исправляет недочеты, которые были допущены при монтаже и устройстве оборудования во время капремонта. Только после этого дом можно предъявить поставщику тепла, – пояснили в УК «ПИК-Комфорт». – На 94% многоквартирных домов подписаны акты полной готовности. На наш взгляд, это говорит о том, что несмотря на, что фактически многоквартирные дома готовы принять теплоноситель, некоторые ресурсоснабжающие организации используют отопительный сезон в качестве средства манипуляции и давления на УК. Поскольку традиционно в сфере ЖКХ сначала оказывается услуга, а ее оплата происходит месяцем позже, у УК перед поставщиками ресурсов существует текущая, объективная задолженность. Именно ее погашения сейчас требуют мелкие ресурсоснабжающие организации, фактически желая получить от УК беспроцентный кредит».

Впрочем, как добавляют в УК «ПИК-Комфорт», ситуация не критическая. Ведь крупней поставщик тепла и воды в Воронеже – филиал ПАО «Квадра» – Воронежская генерация» проверил и принял многоэтажки. В результате управляющие компании получили документы о готовности.

«УК уверены, что воронежские власти не позволят мелким ресурсникам поставить под удар начало отопительного сезона в Воронеже. Тем более, что дома под управлением «ПИК-Комфорт» физически готовы принять теплоноситель», – подытожили в УК «ПИК-Комфорт».

Покупка энергоэффективных газовых водонагревателей для всего дома для всего дома

Безбакерные водонагреватели (также называемые проточными или проточными) нагревают воду по мере необходимости. Когда включается какое-либо приложение (например, смеситель, насадка для душа или стиральная машина), поток воды включает горелку. Для некоторых продуктов для включения горелки требуется минимальный поток 0,5 галлона в минуту (галлонов в минуту). Если расход воды ниже этого уровня, горячая вода не будет. При установке безбаквальных водонагревателей убедитесь, что минимальный поток каждого применения достаточен для включения горелки.

Температура грунтовых вод повлияет на производительность безбаквальных водонагревателей. Очень низкая температура на входе может снизить количество подаваемой горячей воды. Бесконтактные водонагреватели ограничены в количестве применений, которые они могут удовлетворить одновременно. Самые большие доступные водонагреватели без бака обеспечивают около 5 галлонов в минуту. Хотя этой горячей воды достаточно для нескольких применений с низким расходом (например, смесители для ванной) или пары применений с умеренным расходом (например, душа и стиральная машина), большинство водонагревателей без резервуаров не могут удовлетворить два применения с высоким расходом (например, .г., ванна, душ с несколькими насадками) одновременно.

Требования к установке газовых водонагревателей без резервуаров немного отличаются от накопительных. Горелки на газовых водонагревателях могут иметь мощность до 200 000 британских тепловых единиц в час (британских тепловых единиц в час), тогда как горелки в водонагревателях накопительного типа имеют мощность 75 000 британских тепловых единиц в час или меньше. Подводящий трубопровод должен иметь размер, обеспечивающий достаточно газа для больших горелок. Требования к вентиляции для газовых водонагревателей без резервуаров также разные, особенно для наиболее эффективных продуктов.Из-за низкой температуры выхлопных газов и конденсации, которая возникает в результате повышения эффективности, для вентиляционного отверстия необходимы коррозионно-стойкие материалы. Вентиляционные отверстия обычно проходят через стены горизонтально, а не вертикально через крышу, и их длина ограничена примерно 10 линейными футами. Бесконтактные водонагреватели необходимо подключать к дренажным линиям для удаления конденсата.

Ежегодное техническое обслуживание необходимо оценивать при рассмотрении продуктов без резервуаров, особенно в районах с жесткой водой.Проконсультируйтесь с авторитетным местным установщиком, имеющим опыт работы с водонагревателями без резервуаров, чтобы определить надлежащий блок, размеры, установку и требования к техническому обслуживанию для вашей конкретной ситуации.

При сравнении различных типов бытовых газовых безбаквальных водонагревателей для всего дома важно учитывать предполагаемое потребление воды домохозяйством. Как показано в Таблице 2, экономия средств в результате того, что продукты, отвечающие требованиям ENERGY STAR, более эффективны, чем другие модели, увеличивается с увеличением расхода воды.Покупатели могут использовать эту таблицу для получения дополнительной информации при замене стандартных бытовых газовых безбаквальных водонагревателей на более эффективные бытовые газовые безбаквальные водонагреватели.

Таблица 2. Сравнение экономии затрат за весь срок службы для моделей безбакерных водонагревателей ENERGY STAR для всего дома для всего дома при различных уровнях водопользования
Использование воды Очень маленькое Низкое Средний Высокий
Ежедневное потребление воды (галлонов / день) 10 38 55 84
Годовая экономия энергии (термо) 2 8 12 18
Годовая экономия затрат на электроэнергию $ 1 $ 5 $ 8 $ 12
Экономия на пожизненных затратах * $ 16 $ 61 88 134 долл. США

* По сравнению с менее эффективными моделями w с тем же розыгрышем.

Многие штаты и электроэнергетические компании предлагают скидки или другие стимулы для покупки продуктов, сертифицированных ENERGY STAR. Воспользуйтесь средством поиска скидок ENERGY STAR, чтобы узнать, предлагает ли местное коммунальное предприятие такие льготы. Программа стимулирования энергетики FEMP помогает федеральным агентствам воспользоваться этими стимулами, предоставляя информацию о возможностях программы финансирования, доступных в каждом штате.

Многие новые энергопотребляющие бытовые безбаквальные водонагреватели оснащены компонентами обнаружения Интернета вещей (IoT) и возможностью подключения к сети.Совершение новой покупки или замены представляет собой прекрасную возможность оценить уязвимости вашей сети. Все устройства с поддержкой IoT открывают новые возможности для потенциальных утечек данных. Системы управления зданием и системы отопления, вентиляции и кондиционирования не являются исключением. Безопасность практически никогда не может быть подключена к сети постфактум, поэтому важно обеспечить безопасность сетевых устройств. Кроме того, ключевым моментом является регулярное тестирование сетевых уязвимостей. Для получения дополнительной информации о том, как построить кибербезопасные сети строительных технологий, обратитесь к существующим руководствам FEMP и тематическим исследованиям.

Когда можно включить отопление в Италии?

Включение отопления в Италии регулируется региональными правилами для централизованных систем. Жители с автономным отоплением должны соблюдать правила, но имеют немного больше свободы действий.

Уже октябрь, и температура внезапно упала. Здесь холодно и сыро, и было бы так здорово сейчас включить радиаторы!

Когда дело доходит до включения систем отопления в Италии различают централизованные и автономные системы отопления.Разница очень важна, поскольку они следуют разным правилам.



Каждый регион Италии имеет дату активации в соответствии с . Северные регионы могут включать отопление раньше, чем южные.

Здесь, в Милане, 15 октября, -е, — дата, когда можно включить отопление. .

Регулируется не только дата включения, но также температура и количество часов в день, в течение которых радиаторы могут работать.Радиаторы следует выключать на ночь с 23:00 до 5:00 и поддерживать температуру не более 20 ° C (- / + 2 °) в частных домах, офисах и школах и 18 ° C в других общественных зданиях.

Эти правила были установлены с целью экономии энергии и применяются к централизованным системам, где отопление управляется администратором здания. Если вы живете в доме с централизованным отоплением, возможно, вы не сможете регулировать температуру внутри дома.

Жители с автономными системами отопления должны соблюдать и соблюдать правила.Автономные системы отопления позволяют пользователю регулировать температуру и экономить энергию и затраты. Например, уезжая на зимний отпуск, систему можно установить на минимум, тем самым снизив счет за газ или электроэнергию.

Климатические зоны Италии

Инфографика, разработанная DeltaTu Engineering



Климатические зоны в Италии обозначены как от A до F, объединяя районы со схожим климатом и температурой . Самыми жаркими районами являются зоны A, B и C, которые включают муниципалитеты южной Италии, такие как провинции Агридженто, Лампедуза, Порто-Эмпедокле, Катания, Кротоне, Бриндизи, Беневенто, Кальяри, Лечче, Неаполь, Таранто, Палермо и Реджио Калабрия. .

Районы D и E находятся в центральной и северной Италии, где температуры обычно опускаются раньше, как в городах и провинциях, таких как Милан, Генуя, Специя, Анкона, Флоренция, Лукка, Рим, Кьети и Пескара.

Последняя группа, F, объединяет провинции Беллуно, Кунео и Тренто.

Даты включения отопления в Италии
  • 15 октября, зона E (северные регионы)
  • 1 ноября, зона D (центральные районы)
  • 15 ноября, зона C (центральные районы)
  • 1 декабря, зоны A и B (южные регионы)

зона F, входящая в состав некоторых из самых северных районов, не имеет ограничений по использованию системы отопления.

Посмотрите таблицу климатических зон в Италии , чтобы узнать, когда можно включить отопление в вашем районе.

Ограничения по времени Инфографика Qui Finanza

Считается, что это пустая трата энергии. Обычно предполагается, что обогреватели останутся выключенными в ночное время с 23:00 до 5:00.

Каждая климатическая зона Италии имеет максимальное количество часов, в течение которых может работать отопление:

  • Зона A, 6 часов / день
  • Зона B, 8 часов / день
  • Зона C, 10 часов / день
  • Зона D, 12 часов / день
  • Зона E, 14 часов / день
  • Зона F, без ограничений / день

В случае сильного холода или резкого падения температуры возможны исключения.Часто в этих случаях местная мэрия объявляет новые надбавки.

Исключения также предусмотрены для всех зданий с системой учета тепла, где есть централизованная форма отопления или где заключен договор энергосервиса.

Хотите узнать больше?

См. Закон n. 10/1991 (Правила выполнения Национального энергетического плана в отношении использования энергии в стране, энергосбережения и развития возобновляемых источников энергии) и Dpr n.412/1993 (Регламент, устанавливающий правила проектирования, установки, эксплуатации и технического обслуживания тепловых систем зданий с целью ограничения потребления энергии).

Ссылки:

Legge n. 10/1991 (Norme per l’attuazione del Piano energetico nazionale in materia di uso nazionale dell’energia, di risparmio energetico e di sviluppo delle fonti rinnovabili di energia)

Дпр н. 412/1993 (Regolamento recante norme per la progettazione, l’installazione, l’esercizio e la manutenzione degli impianti termici degli edifici ai fini del contenimento dei consumi di energy).

Статья Энтони Райана для Easy Milano

Молекулярная основа тепловой десенсибилизации ионных каналов TRPV1

Заявление об этике

Все эксперименты на животных проводились в строгом соответствии с рекомендациями Руководства по уходу и использованию лабораторных животных Института зоологии Куньмина Китайской академии наук.Протоколы были одобрены институциональными комитетами по уходу за животными и их использованию в Институте зоологии Куньмина Китайской академии наук (идентификатор утверждения: SMKX2016023). Были приложены все возможные усилия, чтобы уменьшить количество используемых животных, а также минимизировать страдания животных.

Животные

Platypus trpv1 «нокаутированных» мышей (p- trpv1 мышей) на фоне C57BL / 6L были получены Cyagen Biosciences, Inc. (Гуанчжоу, Китай). Вкратце, конструирование аллеля trpv1 утконоса было основано на нацеливании на гены, посредством чего комплементарная ДНК, содержащая trpv1 утконоса с кассетой neo , фланкированной loxP, была нацелена на локус, кодирующий TRPV1, с использованием гомологичной рекомбинации.Для проверки нацеливания на локус TRPV1 использовали подходы как полимеразной цепной реакции (ПЦР), так и саузерн-блоттинга. Нацеленные клоны эмбриональных стволовых клеток использовали для получения химерных животных с помощью инъекции на стадии восьми клеток. Самцов мышей с селективной кассетой неомицина скрещивали с самками Cre для получения потомства, а затем инбредировали для получения гомозиготных мышей p- trpv1 и их однопометников WT. Во всех экспериментах в этом исследовании использовали гомозиготных мышей p- trpv1 без кассеты neo , называемых «нокаутированными» мышами platypus trpv1 .В контрольных группах использовали мышей WT C57BL / 6L в возрасте 10–14 недель. Генотипирование животных проводили с использованием следующих праймеров: прямой праймер: 5′-GAACACCGCCTTGCAGTATTTAC-3 ‘и обратный праймер: 5′-CACTGTAGACAAACATGAAGCGAC-3’. Самок мышей использовали для поведенческих экспериментов, если не указано иное. Нейроны DRG были получены как от самцов, так и от самок мышей. Мышей содержали в обычном помещении при 21 ° C в течение 12 часов свет-темнота с неограниченным доступом к пище и воде.

Анализ филогении

Геномные данные, использованные в этом эксперименте, были получены из Ensemble (http: // asia.ensembl.org/index.html, версия 91).

Метод OrthoMCL был использован для идентификации семейства генов выбранных исследуемых видов. Короче говоря, альтернативный сплайсинг каждого гена сначала был отфильтрован, и самые длинные транскрипты были сохранены. Затем все последовательности белков выбранных видов были выполнены с использованием выравнивания Blastp ( E -значение ≤ 1 e -5), при этом другие параметры были установлены по умолчанию. Наконец, чтобы получить семейство гомологичных генов для каждого вида, был применен алгоритм кластеризации модели Маркова.

На основании результатов по семейству генов, описанных выше, было построено филогенетическое дерево изучаемых видов с использованием генов с одной копией, в результате чего было отобрано 5199 семейств генов с одной копией. Для начала использовалось программное обеспечение Mafft для сравнения белковых последовательностей генов однокопийного семейства 5199 и преобразования сравнения белков в сравнение кодирующих последовательностей (CDS). Во-вторых, плохо выровненные области были отфильтрованы с помощью Gblocks с целью получения лучшего файла CDS. Наконец, для анализа использовалась модель GTRGAMMA метода RaxML.Мы установили Bootstrap на 100 и использовали Xenopus tropicalis в качестве вида внешней группы.

Молекулярная биология

TRPV1 мыши (подарок от M.X. Zhu, Научный центр здравоохранения Техасского университета в Хьюстоне, Хьюстон, Техас) и TRPV1 человека использовались в этом исследовании. Platypus trpv1 был синтезирован Цингке (Пекин, Китай) на основе предсказанной последовательности из генома дикого утконоса ( O. anatinus ) (AAPN00000000.1). Последовательность утконоса trpv1 (100077591) была получена автоматическим вычислительным анализом полного О.anatinus геном. eGFP был слит с С-концом TRPV1, чтобы помочь идентифицировать клетки, экспрессирующие канал. Плодовая летучая мышь ( Carollia brevicauda ) trpv1 (JN006859.1), землеройка ( Tupaia belangeri chinensis ) trpv1 (102474103), белый медведь ( Ursus maritimus 103) trpv1 (103) ( Camelus ferus ) trpv1 (102515699) ортологов были синтезированы Цингке на основе предсказанной последовательности гена и субклонированы в вектор pEGFP-N1.

Точечные мутации были созданы с помощью набора Fast Mutagenesis V2 (SBS Genetech, Co., Ltd, Китай). Все мутанты каналов были подтверждены секвенированием ДНК. Химеры TRPV1 мыши и утконоса, использованные в этом исследовании, были получены методом перекрывающегося удлинения 7 и подтверждены секвенированием ДНК. Вкратце, для генерации pV1_mNC, то пары праймеров (5′-CTGATGGGGGAGACAGTGAACAAGATTGCACAAGAGAGC-3 ‘и 5′-GAAGTTGAAGTAAAATATGCGCTTGACAAATCTGTCCCAC-3′) для мыши TRPV1 и пара праймеров (5’-GACAGATTTGTCAAGCGCATATTTTACTTCAACTTCTTC-3 ‘и 5′-CTCTTGTGCAATCTTGTTCACTGTCTCCCCCATCAGGGC-3′) для утконоса использовали TRPV1.pV1_mC был сгенерирован с помощью пары праймеров (5’- CTGATGGGGGAGACAGTGAACAAGATTGCACAAGAGAGC-3 ‘и 5′-CCGGGCCCGCGGTACCGTTTTCTCCCCTGGGGCCATGGA-3′) для мыши TRPV1 и пары праймеров (5’-ATGGCCCCAGGGGAGAAAACGGTACCGCGGGCCCGGGAT-3 ‘и 5′-CTCTTGTGCAATCTTGTTCACTGTCTCCCCCATCAGGGC-3′) для утконосу TRPV1. pV1_mN был сгенерирован с помощью пары праймеров (5’- GATCTCGAGCTCAAGCTTATGGAGAAATGGGCTAGCTTA-3 ‘и 5′-GAAGTTGAAGTAAAATATGCGCTTGACAAATCTGTCCCA-3′) для мыши TRPV1 и пары праймеров (5’-GACAGATTTGTCAAGCGCATATTTTACTTCAACTTCTTC-3 ‘и 5′-GCTAGCCCATTTCTCCATAAGCTTGAGCTCGAGATCTGA-3’) для утконосу TRPV1.

Для создания плазмиды mC сайты ферментов вектора pEGFP-N1 разрезали с помощью HindIII и EcoRI были созданы с помощью QuickCut Hind III и QuickCut EcoR I. Пара праймеров (5′- GCTAGCGTTTAAACTTAAAACAAGATTGCACAAGATAGTTTTGCGAGTCCATC3 ‘и 5’-GCGAGTCCAT ) для TRPV1 мыши. Вектор ферментного расщепления pEGFP-N1 и ПЦР-фрагмент TRPV1 мыши использовали для гомологичной рекомбинации.

Плазмида pC была получена с помощью пары праймеров (5′-GCTAGCGTTTAAACTTAAAACAAGGTCTCGCAAGAAAGC-3 ‘и 5′-CTGGATATCTGCAGAATTTTCTTCTAAAATAAGTGACTC-3’) и использовался фрагмент рекомбинации фермента PCR-TRP1 между рекомбинацией фермента pCR-TR1 и рекомбинацией фермента PPCR1 и рекомбинацией pcR-TR1.

C-концевые пептиды были синтезированы 26 в виде следующих последовательностей:

Pep_30: PEEVQLKHYTGSLKPEDAEVFKDSMAPGEK

Pep_25: LKHYTGSLKPEDAEVFKDSMAPGEK

Pep_20: GSLKPEDAEVFKDSMAPGEK

Случайные пептид: QVEEPTYHKLPKLSGVEADEMSDKFKEGPM

клеточный препарат

HEK293T клетки были приобретены у Куньмином Банк клеток, Институт зоологии Куньмина Китайской академии наук (ATCC, CRL-3216). Клетки культивировали в среде Игла, модифицированной Дульбекко (DMEM), плюс 10% фетальной бычьей сыворотки с 1% пенициллина / стрептомицина, инкубировали при 37 ° C в 5% CO 2 .Клетки временно трансфицировали конструкциями кДНК с помощью Lipofectamine 2000 (Life Technologies, США) в соответствии с протоколом производителя. Через 1-2 дня после трансфекции были выполнены электрофизиологические записи.

Электрофизиология

Все записи были выполнены с использованием усилителя HEKA EPC10 с программным обеспечением PatchMaster (HEKA) 40 . И раствор для пипетки, и раствор для бани содержали 130 мМ NaCl, 3 мМ HEPES и 0,2 мМ EDTA (pH 7,4). Мембранный потенциал поддерживался на уровне 0 мВ, а токи вызывались на уровне ± 80 мВ (500 мс каждый).Пипетки-накладки были изготовлены из боросиликатного стекла и отполированы огнем до сопротивления ~ 4 МОм. Записи всех клеток использовали для проверки функциональности канала, включенного в ANAP. Для записи целых клеток последовательное сопротивление было компенсировано на 60%. Ток регистрировался на частоте 10 кГц и фильтровался на частоте 2,9 кГц. Все записи проводились при комнатной температуре.

Капсаицин перфузировали к мембранному пластырю с помощью гравитационной системы (RSC-200, Bio-Logic). Ванну и капсаицин доставляли через отдельные пробирки, чтобы свести к минимуму перемешивание растворов.Пипетку-пластырь помещали перед выпускным отверстием перфузионной трубки.

Контроль температуры

Контроль температуры достигался перфузией предварительно нагретых или предварительно охлажденных растворов. Растворы нагревали восьмилинейным нагревателем SHM-828, управляемым терморегулятором CL-100 (Harvard Apparatus). Изготовленный на заказ коллектор был прикреплен к выходным портам нагревателя для подачи растворов в записывающую камеру и обеспечения теплоизоляции. Растворы охлаждали путем погружения резервуаров с растворами в ледяную воду и затем перфузировали через отдельную линию.Патч-пипетка была размещена на расстоянии примерно 1 мм от выходных отверстий для раствора. Миниатюрный терморезистор с шариками TA-29 (Harvard Apparatus) был помещен рядом с пипеткой, чтобы обеспечить точный мониторинг местной температуры. Показания температуры термистора подавались на аналоговый вход патч-усилителя и записывались одновременно с током. С помощью этого метода мы добились быстрых и надежных изменений температуры.

Флуоресценция неприродной аминокислоты

Метиловый эфир L-ANAP был приобретен у AsisChem.Вектор pANAP был приобретен у Addgene. ANAP был включен в TRPV1 с мутацией янтарного стоп-кодона TAG 25 . Вкратце, после котрансфекции обоих векторов TRPV1 и pANAP, ANAP был непосредственно добавлен в культуральную среду до конечной концентрации 20 мкМ. Через 1-2 дня культуральную среду, содержащую ANAP, полностью меняли. Клетки дополнительно культивировали в среде без ANAP в течение ночи перед экспериментами.

Флуоресценцию

ANAP возбуждали с помощью Ar-лазера с фильтром возбуждения 375/28, дихроичным зеркалом T400lp и эмиссионным фильтром 435LP на инвертированном флуоресцентном микроскопе (Nikon TE2000-U) с иммерсионным объективом × 40 (числовая апертура (NA ) 1.3). Спектр излучения ANAP был получен с помощью спектрографа Acton SpectraPro 2150i в сочетании с камерой Evolve 512 EMCCD. Пиковое значение излучения было найдено путем аппроксимации спектра искаженным распределением Гаусса.

Прямая запись флуоресценции и количественная оценка FRET

Для регистрации флуоресценции eGFP / eYFP был связан с С-концом канала TRPV1, а метиловый эфир L-ANAP был включен в N-конец TRPV1 с мутацией янтарного стоп-кодона TAG. Мониторинг изменения амплитуды флуорофора во времени сопровождался зажимом цельноклеточного пластыря.

Система визуализации построена на микроскопе Nikon TE2000-U. Возбуждающий свет генерировался аргоновым лазером. Продолжительность светового воздействия контролировалась механическим затвором с компьютерным управлением (Uniblitz). В этих экспериментах использовался масляно-иммерсионный объектив A × 40 (NA 1,30). Спектральные измерения проводились с помощью спектрографа Acton SpectraPro 2150i в сочетании с камерой Evolve 512 EMCCD. И затвор, и камера управлялись программным обеспечением MetaMorph (Universal Imaging), синхронизированным с PatchMaster.Таким образом, одновременно регистрировались текущее и спектральное изображение. Из спектрального изображения рассчитывали соотношение интенсивностей eGFP / ANAP или eYFP / ANAP, которое использовали для отслеживания конформационных изменений динамического стробирования во время стробирования.

В режиме спектров FRET использовались два куба фильтра (Chroma). Куб I содержал AT375 / 28 × (возбуждение), ZT349rdc (дихроичный) и ET500 / 40 m (излучение), а куб II содержал ZET488 / 10 ×, ZT458rdc и ET510 / 80m. Для каждой ячейки были получены два спектроскопических изображения: одно с возбуждением ANAP при 375 нм с использованием куба I и другое с возбуждением eGFP / eYFP при 490 нм с использованием куба II.По этим двум изображениям был построен полный спектр излучения.

Молекулярное моделирование

Для моделирования индуцированного теплом десенсибилизированного состояния TRPV1, моделирование петли симметрии мембраны было выполнено с использованием пакета молекулярного моделирования Rosetta 41 версия 2015.25. Поскольку состояние TRPV1, активируемое теплом, еще не было экспериментально определено, мы использовали открытое состояние, связанное с DkTx и RTX (идентификатор PDB: 3J5Q), в качестве стартовой структуры, поскольку предыдущие исследования показали, что эти токсины активируют канал за счет тепла. путь активации 26,27 .Фильтр селективности, линкер pre S6 и линкер S1-S2 были смоделированы de novo с помощью протокола моделирования кинематической петли (KIC) 42,43 . Каждый раунд генерировалось от десяти тысяч до 20 тысяч моделей. Эти модели были сначала отфильтрованы по значению SASA на сайте 630. Допускались только модели с уменьшением SASA> 20 Å 2 по сравнению с открытым состоянием. Среди отфильтрованных моделей в качестве входных данных для следующего раунда моделирования контура были выбраны 20 лучших по энергии моделей.После 14 раундов моделирования петли KIC десять лучших моделей хорошо сошлись. В итоге в качестве модели десенсибилизированного состояния была выбрана модель с наименьшей энергией. Эта модель была дополнительно усовершенствована приложением Relax 44 в составе пакета Rosetta.

Чтобы смоделировать конформацию боковой цепи ANAP в рамках моделей TRPV1, мы создали библиотеку ротамеров ANAP, как описано 25,45 . Вкратце, химическая структура ANAP была оптимизирована с помощью гауссовой версии 09 46 .Затем скелетно-зависимая библиотека ротамеров была сгенерирована приложением MakeRotLib 45 в Rosetta. Затем остаток ANAP был включен в модели TRPV1 в открытом и десенсибилизированном состояниях с помощью приложения Backrub 47,48 в Rosetta. Для каждого состояния было сгенерировано 5000 моделей и выбрана модель с наименьшей энергией.

Командные строки, используемые в Rosetta для выполнения процессов моделирования, были прикреплены к методу. SASA каждого остатка в моделях структур TRPV1 измеряли с помощью RosettaScripts 49 в рамках набора Rosetta.Скрипты для выполнения измерений и фильтрации SASA также были прикреплены к дополнительным методам.

Точно так же взаимодействие между дистальными N- и C-концами TRPV1 также было смоделировано de novo с помощью протокола моделирования петли KIC 42,43 .

Радиус пор модели TRPV1 рассчитан с помощью программы HOLE 50 версия 2.0 51 .

Вся молекулярная графика моделей TRPV1 была визуализирована с помощью программного обеспечения UCSF Chimera 52 версии 1.12 53 .

нейронов DRG

нейронов DRG были резко диссоциированы и поддерживались в кратковременной первичной культуре в соответствии с процедурами 54 . Вкратце, после того, как мышей умерщвляли вдыханием CO 2 и обезглавливали, позвоночный столб был открыт дорсальным доступом. Нейроны DRG собирали с помощью тонких пинцетов с обеих сторон позвоночного столба и переносили в среду DMEM (GIBCO), спинномозговые нервы отрезали с помощью тонких офтальмологических ножниц и расщепляли 22% коллагеназы и 12% трипсина (м / м, Sigma ) в течение 20 мин.После промывки коллагеназой и трипсином нейроны DRG инкубировали при 37 ° C в 5% CO 2 . Клетки использовали для электрофизиологических экспериментов в течение следующих 24 часов.

Гистологический анализ

После фиксации 10% формалином и обезвоживания с помощью возрастающей концентрации спирта материалы лап залили парафином и сделали срезы толщиной 5 мкм с помощью гистограммы (Leica). Срезы тканей лап депарафинизировали и регидратировали для окрашивания гематоксилином и эозином.

Иммуноблоттинг

Ноги мышей разрезали на мелкие кусочки и гомогенизировали, используя основной ULTRA-Turrax (IKA) в буфере для лизиса RIPA (R0278, Sigma) с добавлением ингибиторов протеаз (P8340, Sigma) и ингибиторов фосфатазы (P5726, Sigma). . После 20-минутной стадии инкубации при 4 ° C и осветления центрифугированием при 4 ° C (15 минут, 12000 × г ) супернатанты собирали. Концентрации белка в супернатантах измеряли с помощью набора для анализа BCA (23225, Thermo).Всего 40 мкг образцов белка кипятили в буфере для образцов для электрофореза в SDS-полиакриламидном геле (PAGE) (BL502A, Biosharp) в течение 5 минут, а затем разделяли 12% SDS-PAGE с последующим электропереносом на поливинилиденфторид (PVDF). мембраны (ISEQ00010, Millipore). После блокирования 5% бычьим сывороточным альбумином (4240GR100, Biofroxx), растворенным в трис-буферном физиологическом растворе, содержащем 0,1% твин-20 (TBST, 2,42 г л -1 Трис-основание, 8 г л -1 NaCl, 0,1% Tween-20 pH 7,6) при комнатной температуре в течение 1 ч мембраны PVDF инкубировали в течение ночи с первичными антителами при 4 ° C.Затем их трижды промывали с помощью TBST перед инкубацией со вторичными антителами в течение 1 ч при комнатной температуре. После инкубации мембраны снова трижды промывали TBST, затем подвергали воздействию хемилюминесцентных реагентов и снимали изображения с помощью прибора ImageQuant LAS 4000 (GE HealthCare). Иммуноблоттинг проводили с использованием следующих антител: кроличьих mAb каспазы-3 (8G10) (# 9665, Cell Signaling) и антител к β-актину мыши (sc-69879, Santa Cruz), которые использовали в качестве первичных антител, и пероксидазы хрена. Меченые антитела против кролика (№7074, Cell Signaling) или антитела против мыши (№7076, Cell Signaling) использовали в качестве вторичных антител.

Поведение животных

Для анализа с погружением в хвост мышей иммобилизовали в алюминиевой фольге, которая позволяла свободное движение хвоста. Кончик хвоста (одна треть длины) погружали в водяную баню, поддерживаемую при 45 ° C, и определяли латентный период до отрыва хвоста. Хвост удаляли из ванны сразу после ноцицептивного ответа, чтобы предотвратить острое повреждение тканей.

Для анализа с горячей пластиной мышей по отдельности помещали в камеру из оргстекла на металлической поверхности, установленной на 45, 48, 50 и 52 ° C, и латентность до ноцицептивного ответа (облизывание или встряхивание задних лап, прыжки ) был определен.Мышей удаляли с горячей пластины после ноцицептивного ответа, чтобы предотвратить повреждение ткани.

Для анализа пройденного расстояния за мышами индивидуально отслеживали в течение 60 минут, заключенных в камеру из оргстекла на металлической поверхности, установленной на 45 ° C (CIB, Inc.), которая состояла из пластины с регулируемой и стабильной температурой на алюминиевом полу. Отслеживание производилось с использованием системы на основе видеокамеры (ZS Dichuang), и определялась пройденная дистанция.

Для итеративного анализа горячей пластиной мышей по отдельности помещали в камеру из оргстекла на металлической поверхности, установленной на 45 ° C, в течение 30 минут с интервалом 4 часа и повторяли десять раз.После термообработки 45 ° C лапы мышей использовали для гистологического анализа и выявления воспалительных факторов.

РНК-секвенирование

После того, как мышей умерщвляли ингаляцией CO 2 , нейроны DRG выделяли и хранили в жидком азоте до дальнейшей обработки. РНК из DRG как WT, так и p -trpv1 взрослых мышей-самцов выделяли с использованием RNeasy Mini Kit (Qiagen) в соответствии с протоколом производителя. Библиотеки секвенирования были сконструированы из общей РНК и были подвергнуты нормализации DSN в соответствии с протоколом, который предоставляется с комплектом NEBNext Ultra RNA Library Prep Kit (New England Biolabs, Inc.), и каждую библиотеку секвенировали на hiseq X ten в соответствии с рекомендациями производителя, получая считывания парных концов 150 пар оснований (NextOmics, Inc.). Чтения были согласованы с помощью инструмента Tophat2 с открытым исходным кодом, поддерживающего монтажную стыковку (v2.0.5). Подсчет считывания для каждой функции (гены или экзоны) проводился StringTie (v1.3.0). Данные подсчета были проанализированы для идентификации дифференциально экспрессируемых генов с использованием DESeq2 (v1.01.1) при FDR 5%.

Анализ данных

Все эксперименты независимо повторяли не менее трех раз.Все статистические данные выражены в виде средних значений ± стандартная ошибка среднего. Для проверки статистической значимости применялся двусторонний критерий Стьюдента t . Статистическая значимость принята на уровне P <0,05. NS указывает на отсутствие существенной разницы.

Сводка отчетов

Дополнительная информация о дизайне исследования доступна в Сводке отчетов по исследованиям природы, связанной с этой статьей.

Холодный случай того, что нагревает пароходный гейзер в Йеллоустоне

Йеллоустонский национальный парк — это изобилие геологических богатств, от обширных вулканических пейзажей до пузырящихся котлов с разноцветными ирисами.Но одно из его 10 000 термальных объектов недавно привлекло всеобщее внимание: пароходный гейзер.

Пароход, самый высокий активный гейзер в мире, может запускать перегретую воду почти на 400 футов в небо. Эти извержения носили случайный характер, с перерывами между крупными выбросами, которые длились от четырех дней до 50 лет. Но в марте 2018 года он начал потрясающее выступление, которое не показывает никаких признаков угасания. 129 извержений гейзера с момента его пробуждения до настоящего времени превышают общее количество извержений гейзера из парохода за предыдущие полвека.

Естественно, ученые хотят знать, что послужило началом этой демонстрации яркой текучести.

И исследование, опубликованное в понедельник в Proceedings of the National Academy of Sciences, по крайней мере исключило некоторые виновники, такие как землетрясения или снегопад. Несмотря на то, что ученые не смогли определить главного подозреваемого, открытие расширяет научные знания о природной инженерии, лежащей в основе гейзеров, что в лучшем случае остается нечетким.

«Мы до сих пор не можем объяснить простые вещи о том, как они работают», — сказала Мара Рид, аспирантка Калифорнийского университета в Беркли и ведущий автор исследования.»Есть еще много всего, чему можно научиться».

Ее соавтор Майкл Манга, геолог из Калифорнийского университета в Беркли, согласился с тем, что гейзеры представляют собой упрощенные вулканы. «Если мы не можем понять гейзер, наши шансы понять магматические вулканы намного ниже», — сказал он.

Гейзеры — это водометы, работающие на вулканической энергии. Магма глубоко под землей нагревает горные породы наверху, которые, в свою очередь, нагревают неглубокий перезаряжаемый источник воды, хранящийся под давлением. Измените подачу воды или тепла, или измените пути к поверхности — скажем, через минералы, кристаллизующиеся из жидкости и образующие пробку, — и поведение гейзера изменится.

Изменение является нормой для термических особенностей Йеллоустоуна. С тех пор, как более века назад начались подробные наблюдения за ртутной гидротермальной системой супервулкана, лежащей в основе парка, наблюдатели видели бесчисленные теплые пятна, горячие источники и гейзеры, которые приходят и уходят. Это означает, что резкий переход Steamboat не лишен места, сказал Майкл Поланд, научный сотрудник Йеллоустонской вулканической обсерватории Геологической службы США, который не принимал участия в новой работе.

Но частые извержения Парохода, наряду с множеством современных научных датчиков, разбросанных по парку, и наблюдения гражданских ученых, дали исследователям прекрасную возможность изучить, что движет им, и позволили г-же Мисс.Команда Рида ищет объяснения драматической активации гейзера в 2018 году.

Могут ли быть виноваты землетрясения? Рой землетрясений действительно предшествовал активации парохода, но такие толчки не смогли сотрясать землю с достаточной силой, чтобы перестроить геологические водопроводы под землей и изменить поведение гейзера.

Однако достаточное количество осадков могло способствовать гиперактивности Steamboat: извержения наблюдались чаще между поздней весной и серединой лета, когда на землю попадает тающий снег.Но, как сказал доктор Манга, химический состав фонтанов говорит о том, что это не свежее таяние снега. Вместо этого дождевая вода может накапливаться под давлением и вызывать извержение старых очагов горячей воды.

И все же таяние снега не было первым спусковым крючком. Не было никакой корреляции между количеством осадков, выпавших, по оценкам, в бассейне Норрис Гейзер, в котором находится Пароход, и пробуждением Парохода.

Секция этого бассейна размером с Чикаго в последнее время поднимается и опускается по высоте, и недавнее исследование показало, что это было вызвано движением карманов гидротермальных жидкостей и, в конечном итоге, их скоплением прямо под поверхностью.Это также рассматривалось как возможное объяснение недавней активации Steamboat.

Но, сказал доктор Манга, недавно прибывшая неглубокая лужа горячих жидкостей должна была запустить множество спящих гейзеров в регионе, а не только пароход. Местные гидротермальные объекты также должны были стать заметно более горячими, но однозначного всплеска температуры обнаружено не было.

Отсутствие окончательных ответов может расстраивать некоторых. Но для мисс Рид сыграть детектива в Steamboat — это сбывшаяся мечта.Последний крупный период извержения был в 1980-х годах, до ее времени. Она подумала, что упустила шанс увидеть одно из зрелищных шоу. «Теперь я должна это увидеть, — сказала она, — и каждый раз это поражало меня».

Amazon.com: Грелки для рук HotHands — Долговечные безопасные натуральные грелки без запаха, активируемые воздухом — до 10 часов нагрева

Принесите тепло!

HotHands — это одноразовые тепловые пакеты, активируемые воздухом, которые обеспечивают повседневное тепло и идеально подходят для согрева рук в холодную погоду.Они обеспечивают безопасное естественное тепло, поэтому вы можете наслаждаться свежим воздухом в суровые зимние месяцы. Наши грелки для рук помещаются в карманах или на ладони. Удобный, компактный, портативный. Благодаря продуманному дизайну, вы можете пользоваться HotHands в любое время и в любом месте.

Спецификации и детали:
• Количество: 3 индивидуальных подогревателя рук.
• Продолжительность нагрева: до 10 часов нагрева.
• Время активации: 15-30 минут.
• Средняя температура: 135 градусов по Фаренгейту (57 градусов по Цельсию).
• Максимальная температура: 158 градусов по Фаренгейту (70 градусов по Цельсию).
• Состав: железный порошок, вода, соль, активированный уголь и древесное волокно.
• Страна происхождения: Сделано в США с использованием отечественных и импортных материалов.
• Хранение: Хранить в прохладном месте, защищенном от прямых солнечных лучей.

Trusted — HotHands, лидер в производстве грелок с воздушным приводом, согревает руки, ноги и тело уже более 20 лет. Этому бренду во всем мире доверяют профессиональные спортсмены, любители активного отдыха, зрители, лыжники, работники на открытом воздухе и все, кто хочет безопасного, удобного и концентрированного тепла в холодную погоду.

Инструкции — Не открывайте внешнюю упаковку, пока не будете готовы к использованию. Извлеките грелку из внешней упаковки: встряхните, чтобы активировать. Не открывайте, не протыкайте и не разрывайте подогреватель. Грелка нагревается за 15-30 минут. Если температура уменьшается, выставьте теплый воздух на воздухе и встряхните. После использования утилизируйте вместе с обычным мусором. Ингредиенты не нанесут вреда окружающей среде.

Покупайте с уверенностью. Чтобы гарантировать получение подлинных продуктов HotHands при совершении покупок в Интернете, покупайте только у официальных дистрибьюторов или розничных продавцов или в списках Amazon, в которых четко указано, что продукт продается и доставляется непосредственно Amazon.com. Неавторизованные продавцы, такие как частные продавцы (не коммерческие продавцы), могут предлагать устаревшие продукты или имитации, не соответствующие стандартам качества HotHands. Мы хотим, чтобы наши клиенты покупали наши продукты с уверенностью, что они получают подлинные и качественные продукты HotHands.

Основы спринклерной системы

: типы спринклерных систем

При проектировании спринклерной системы одно из первых решений, которое должен принять проектировщик, — это тип спринклерной системы, которую следует установить.Типы спринклерных систем, допустимых NFPA 13, Стандарт для установки спринклерных систем , , : влажные, сухие, с предварительным срабатыванием и дренчерные. Другие типы систем пожаротушения, такие как чистящие средства или водяной туман, регулируются другими стандартами. При выборе соответствующего типа спринклерной системы важно сначала понять различия между системами, а затем понять, как эти различия могут быть полезными или вредными при определенных условиях.Выбор неправильного типа системы может быть дорогостоящим.

Системы влажных труб

Спринклерные системы с мокрыми трубами являются наиболее распространенными. В этой системе спринклерный трубопровод постоянно заполнен водой. Когда температура на потолке становится достаточно высокой, стеклянная колба или плавкая вставка в спринклерной системе лопаются. Поскольку система уже заполнена водой, вода может свободно вытекать из этой спринклерной головки. Вопреки тому, что вы думаете в Голливуде, не все спринклерные головки будут работать одновременно в этом типе системы.Температура вокруг этой конкретной спринклерной головки должна быть достаточно высокой, чтобы разбить стеклянную колбу или плавкую перемычку, сдерживающую воду. Как только это произойдет, вода сразу же потечет только из этой головы.

Спринклерные системы с мокрыми трубами являются наиболее надежными и экономичными. Поэтому они должны рассматриваться в первую очередь при выборе спринклерной системы. Однако бывают случаи, когда спринклерная система с мокрыми трубами может не подходить. Одним из основных факторов при определении возможности использования влажной системы труб является температура защищаемого помещения.Будут ли все зоны здания, где проложен спринклерный трубопровод, выдерживать температуру не менее 40 ° ° F (4 ° ° C) или выше? Если ответ положительный, то опасность замерзания воды в трубопроводе отсутствует, и влажная система является предпочтительным методом. Однако, если ответ отрицательный, может потребоваться дополнительное исследование, чтобы определить, сможет ли инженер доказать, что, хотя температура может упасть ниже 40 O F (4 O C), она никогда не упадет достаточно низко для воду заморозить.Если невозможно гарантировать температуру в помещении, чтобы исключить риск замерзания воды, следует выбрать другой тип системы.

Системы сухих труб

Системы с сухими трубами очень похожи на системы с мокрыми трубами с одним существенным отличием. Труба не наполняется водой постоянно. Вместо этого вода удерживается за клапаном с сухой трубой, обычно на некотором расстоянии от места расположения спринклеров. Подобно системе влажных труб, когда температура на потолке становится достаточно высокой, стеклянная колба или плавкая вставка спринклера ломается.Однако в этом случае вода недоступна сразу, потому что труба не заполнена водой. Вместо этого воздух выпускается из теперь открытой спринклерной головки. Это приводит к падению давления, в результате чего открывается сухой клапан и вода заполняет систему. Затем вода потечет из открытой спринклерной головки. Поскольку существует задержка между срабатыванием оросителя и расходом воды, размер систем с сухими трубами ограничен. Ограничение размера предназначено для минимизации времени задержки подачи воды.

Система сухих труб — отличный вариант для помещений без кондиционирования или мест, где нельзя гарантировать достаточно высокую температуру для предотвращения замерзания воды в системе.Важно отметить, что по крайней мере в той части здания, куда поступает вода и где расположен клапан с сухим трубопроводом, должна быть достаточно высокая температура, чтобы предотвратить замерзание.

Системы предварительного действия

Из всех типов спринклерных систем, пожалуй, самой сложной является система предварительного срабатывания. Существует три различных типа систем предварительного срабатывания: система без блокировки, система с одной блокировкой и система с двойной блокировкой. Основное различие между системами предварительного срабатывания и системами с мокрым и сухим трубопроводом состоит в том, что определенное событие (или события) должно произойти до того, как вода попадет в систему.Это может показаться похожим на систему с сухими трубами, но разница заключается в том, какое событие вызывает выпуск воды:

  • Для системы без блокировки: срабатывание устройств обнаружения OR автоматических спринклеров
  • Для одиночной системы блокировки: срабатывание устройств обнаружения
  • Для системы двойной блокировки: срабатывание устройств обнаружения И автоматических оросителей

Чтобы лучше объяснить, как работают эти типы систем, мы рассмотрим пример, использующий комнату, защищенную спринклерами, питаемыми от системы предварительного срабатывания.В дополнение к спринклерам, в комнате есть полностью автоматическое обнаружение тепла. Обычно система обнаружения имеет более низкий температурный рейтинг, чем спринклеры. Это поможет обеспечить активацию системы обнаружения до того, как сработает спринклерная головка. В этом случае тепловые извещатели с рейтингом 135 O F будут служить нашей системой обнаружения, а спринклеры будут иметь рейтинг температуры 165 O F.

В случае отсутствия пожара, такого как случайное повреждение спринклерной головки, которое приводит к поломке стеклянной колбы, система будет заполняться водой в системе без блокировки, и вода будет вытекать из сломанной спринклерной головки.Такая же ситуация в системе предварительного срабатывания с одной блокировкой не приведет к потоку воды, потому что разбитая стеклянная колба не вызовет заполнение системы водой. Только срабатывание устройств обнаружения приведет к заполнению системы водой для единой системы блокировки.

В одном помещении системы без блокировки и с одной блокировкой работают одинаково при возникновении пожара. Сначала должны сработать тепловые извещатели, так как они имеют более низкую номинальную температуру. Как для системы без блокировки, так и для системы с одной блокировкой активация тепловых извещателей приведет к заполнению системы водой.Затем, если температура продолжит расти, сработает ороситель. Поскольку «событие», обнаружение тепла, уже произошло, система заполнена водой, и мы ожидаем, что она будет действовать как традиционная система влажных труб. В этой же ситуации система двойной блокировки не будет заполняться водой после активации обнаружения тепла. Вместо этого система будет заполняться водой только после активации системы обнаружения тепла и срабатывания спринклерной головки. Следовательно, произойдет задержка подачи воды, аналогичная той, что наблюдается в системах с сухими трубами.По этой причине системы предварительного срабатывания с двойной блокировкой имеют такие же ограничения по размеру, что и системы с сухими трубами, тогда как системы без блокировки и с одной блокировкой ограничиваются только 1000 спринклерными головками на клапан предварительного срабатывания.

Дополнительные соображения, помимо температуры, могут привести к выбору другого типа разрешенной спринклерной системы. В некоторых случаях может возникнуть желание минимизировать риск повреждения водой или предотвратить случайное заполнение системы. В этих случаях предпочтительным вариантом может быть одинарная или двойная система блокировки.Единая система блокировки может быть полезна в музеях, компьютерных залах или подобных местах, где существует проблема повреждения водой. Это исключит риск случайного вытекания воды в случае повреждения спринклерной головки. Хотя NFPA 13 специально не запрещает использование систем двойной блокировки в помещениях такого типа, система предварительного срабатывания двойной блокировки не была разработана для таких ситуаций. Он был предназначен для использования на складах с морозильной камерой или в аналогичных ситуациях, когда случайное попадание воды в систему трубопроводов приведет к дорогостоящему восстановлению.Перед выбором этого типа системы важно учитывать задержку подачи воды, которая возникает в системе предварительного срабатывания двойной блокировки. Если он используется в музее или подобном типе окружающей среды, задержка подачи воды позволит пожару продолжить расти, что может привести к открытию дополнительных спринклеров. В свою очередь, это может увеличить ущерб от воды и привести к вовлечению большей части здания.

Дренчерные системы похожи на системы предварительного срабатывания в том, что они используют другой тип обнаружения для работы.Однако самая большая разница в том, что в дренчерных системах используются открытые спринклеры или форсунки. Вместо того, чтобы получать воду от отдельных работающих головок, после того, как вода заполняет систему, вода будет течь из каждой спринклерной головки. Подобно системе предварительного срабатывания, дренчерный клапан предотвращает попадание воды в систему до тех пор, пока не сработает другой тип системы обнаружения, такой как обнаружение дыма. Как только эта система обнаружения активирована, вода не только заполняет систему, но и течет из открытых спринклеров или форсунок.

Еще одним фактором, который следует учитывать при выборе типа спринклерной системы, является уровень защищаемой опасности. При защите зоны очень высокой опасности, такой как подвесы самолетов, система затопления может быть наиболее подходящей.

Каждый тип системы имеет свои уникальные преимущества. При выборе спринклерной системы, подходящей для вашей конкретной среды, важно учитывать плюсы и минусы каждого типа системы. Целое здание может быть защищено комбинацией систем.Например, один из наиболее распространенных проектов на северо-востоке — защита частей здания, кондиционируемых с помощью системы влажных трубопроводов, и использование систем сухих труб на чердаке и других некондиционированных участках. Комбинирование различных типов систем для полной защиты здания позволяет проектировщику рассмотреть каждую уникальную среду и применить наиболее подходящий тип системы к этому пространству, не жертвуя тем, что лучше всего подходит для других частей здания.

3.2 Введение в системы обнаружения пожара, сигнализации и автоматических пожарных спринклеров — NEDCC

Вернуться к списку

Abstract

На управление культурными ценностями возложена ответственность за защиту и сохранение зданий, коллекций, операций и жителей учреждения.Требуется постоянное внимание, чтобы свести к минимуму неблагоприятное воздействие из-за климата, загрязнения, кражи, вандализма, насекомых, плесени и огня. Из-за скорости и совокупности разрушительных сил огня он представляет собой одну из наиболее серьезных угроз. Постройки, подвергшиеся вандализму или повреждению окружающей среды, можно отремонтировать, а украденные предметы вернуть обратно. Однако предметы, уничтоженные пожаром, ушли навсегда. Неконтролируемый пожар может уничтожить все содержимое комнаты за несколько минут и полностью сжечь здание за пару часов.

Первый шаг к остановке пожара — это правильно определить происшествие, поднять тревогу для пассажиров и затем уведомить специалистов по реагированию на чрезвычайные ситуации. Часто это функция системы обнаружения пожара и сигнализации. Доступны несколько типов и опций систем в зависимости от конкретных характеристик защищаемого помещения.

Эксперты по противопожарной защите в целом согласны с тем, что автоматические спринклеры представляют собой один из наиболее важных аспектов программы управления пожарами.Правильно спроектированные, установленные и обслуживаемые, эти системы могут устранить недостатки в управлении рисками, строительстве зданий и аварийном реагировании. Они также могут обеспечить повышенную гибкость проектирования зданий и повысить общий уровень пожарной безопасности.

Следующий текст представляет собой обзор систем обнаружения пожара, сигнализации и спринклерных систем, включая типы систем, компоненты, операции и ответы на общие вопросы.

Рост и поведение огня

Прежде чем пытаться понять системы обнаружения пожара и автоматические спринклеры, полезно иметь базовые знания о развитии и поведении пожара.Благодаря этой информации можно лучше понять роль и взаимодействие этих дополнительных систем пожарной безопасности в процессе защиты.

По сути, пожар — это химическая реакция, при которой материал на основе углерода (топливо) смешивается с кислородом (обычно как компонент воздуха) и нагревается до точки, при которой образуются воспламеняющиеся пары. Эти пары могут затем вступить в контакт с чем-то достаточно горячим, чтобы вызвать воспламенение пара и, как следствие, пожар. Проще говоря, что-то, что может обжечь, касается чего-то горячего, и возникает пожар.

Библиотеки, архивы, музеи и исторические сооружения часто содержат множество видов топлива. К ним относятся книги, рукописи, записи, артефакты, горючие материалы для внутренней отделки, шкафы, мебель и лабораторные химикаты. Следует понимать, что любой предмет, содержащий дерево, пластик, бумагу, ткань или горючие жидкости, является потенциальным топливом. Они также содержат несколько общих потенциальных источников воспламенения, включая любой предмет, действие или процесс, выделяющий тепло. Сюда входят электрические системы освещения и электроснабжения, оборудование для отопления и кондиционирования воздуха, работы по сохранению и техническому обслуживанию тепла, а также офисные электрические приборы.Строительные работы, вызывающие пламя, такие как пайка, пайка и резка, являются частыми источниками возгорания. К сожалению, поджог является одним из наиболее распространенных источников возгорания культурных ценностей, и его всегда следует учитывать при планировании пожарной безопасности.

При контакте источника возгорания с топливом может начаться пожар. После этого контакта типичный случайный пожар начинается как процесс медленного роста и тления, который может длиться от нескольких минут до нескольких часов. Продолжительность этого «начального» периода зависит от множества факторов, включая тип топлива, его физическое расположение и количество доступного кислорода.В этот период увеличивается тепловыделение, в результате чего выделяется легкий или средний объем дыма. Характерный запах дыма обычно является первым признаком того, что начался пожар. Именно на этом этапе раннее обнаружение (либо человеческое, либо автоматическое) с последующим своевременным ответом квалифицированных специалистов по пожарной безопасности может контролировать пожар до того, как возникнут значительные потери.

Когда пожар достигает конца начального периода, обычно выделяется достаточно тепла, чтобы позволить возникновение открытого видимого пламени.Как только возникло пламя, пожар переходит из относительно незначительной ситуации в серьезное событие с быстрым ростом пламени и тепла. Температура потолка может превышать 1000 ° C (1800 ° F) в течение первых минут. Это пламя может воспламенить соседнее горючее содержимое в комнате и немедленно поставить под угрозу жизнь обитателей комнаты. В течение 3-5 минут потолок комнаты действует как жаровня, поднимая температуру достаточно высоко, чтобы «вспыхнуть», что одновременно воспламеняет все горючие вещества в комнате.На этом этапе большая часть содержимого будет уничтожена, и человеческая выживаемость станет невозможной. Будет происходить дымообразование, превышающее несколько тысяч кубических метров (футов) в минуту, затрудняя видимость и удаляя содержимое, удаленное от огня.

Если здание структурно прочное, тепло и пламя, скорее всего, поглотят все оставшиеся горючие вещества, а затем самозатухнут (выгорят). Однако, если огнестойкость стен и / или потолка недостаточна (например, открытые двери, прорывы в стене / потолке, горючие конструкции здания), пожар может распространиться на соседние помещения и начать процесс заново.Если пожар останется неконтролируемым, в конечном итоге может произойти полное разрушение или «выгорание» всего здания и его содержимого.

Успешное тушение пожара зависит от тушения пламени до или сразу после пламенного горения. В противном случае нанесенный ущерб может оказаться слишком серьезным, чтобы от него можно было избавиться. В начальный период обученный человек с портативными огнетушителями может быть эффективной первой линией защиты. Однако, если немедленное реагирование не дает результата или пожар быстро разрастается, возможности пожаротушения могут быть превышены в течение первой минуты.Тогда становятся необходимыми более мощные методы подавления, будь то пожарные шланги или автоматические системы.

Пожар может иметь далеко идущие последствия для зданий, содержимого и предназначения учреждения. Общие последствия могут включать:

  • Коллекции повреждений. В большинстве учреждений наследия хранятся уникальные и незаменимые предметы. Тепло и дым, образующиеся при пожаре, могут серьезно повредить или полностью разрушить эти предметы, не подлежащие ремонту.
  • Повреждения операций и миссий.В помещениях наследия часто находятся учебные заведения, лаборатории консервации, службы каталогов, офисы административного / вспомогательного персонала, выставочное производство, розничная торговля, общественное питание и множество других мероприятий. Пожар может их отключить, что отрицательно скажется на миссии организации и ее клиентуре.
  • Повреждение конструкции. Здания представляют собой «оболочку», которая защищает коллекции, операции и жителей от погодных условий, загрязнения, вандализма и многих других элементов окружающей среды.Пожар может разрушить стены, полы, конструкции потолка / крыши и несущие конструкции, а также системы освещения, контроля температуры и влажности и подачи электроэнергии. Это, в свою очередь, может привести к повреждению контента и дорогостоящим действиям по перемещению.
  • Утрата знаний. Книги, рукописи, фотографии, фильмы, записи и другие архивные коллекции содержат огромное количество информации, которая может быть уничтожена пожаром.
  • Травма или потеря жизни. Жизнь персонала и посетителей может быть подвергнута опасности.
  • Влияние связей с общественностью. Персонал и посетители ожидают, что в исторических зданиях будут созданы безопасные условия. Те, кто жертвует или дает ссуды, полагают, что эти предметы будут в сохранности. Сильный пожар может поколебать общественное доверие и оказать влияние на связи с общественностью.
  • Безопасность зданий. Пожар представляет собой величайшую угрозу безопасности! Если учесть такое же количество времени, случайный или преднамеренный поджог может нанести гораздо больший вред коллекциям, чем самые опытные воры.Огромные объемы дыма и токсичных газов могут вызвать замешательство и панику, тем самым создавая идеальную возможность для незаконного проникновения и кражи. Потребуются неограниченные операции по тушению пожаров, что усугубит угрозу безопасности. Обычное дело — поджоги, устроенные для сокрытия преступления.

Чтобы свести к минимуму риск пожара и его воздействие, учреждениям, занимающимся наследием, следует разработать и внедрить комплексные и объективные программы противопожарной защиты. Элементы программы должны включать меры по предотвращению пожаров, улучшение конструкции зданий, методы обнаружения развивающегося пожара и оповещения аварийного персонала, а также средства эффективного тушения пожара.Каждый компонент важен для общего достижения цели организации в области пожарной безопасности. Для руководства важно наметить желаемые цели защиты во время пожара и разработать программу, направленную на достижение этих целей. Таким образом, основной вопрос, который задают менеджеры объекта: «Какой максимальный размер пожара и убытки может принять учреждение?» С помощью этой информации может быть реализована целенаправленная защита.

Системы обнаружения пожара и сигнализации

Введение
Ключевым аспектом противопожарной защиты является своевременное выявление развивающейся пожарной чрезвычайной ситуации и оповещение жителей здания и пожарных аварийных организаций.Это роль систем обнаружения пожара и сигнализации. В зависимости от ожидаемого сценария пожара, типа здания и использования, количества и типа людей, а также критичности содержимого и предназначения эти системы могут выполнять несколько основных функций. Во-первых, они предоставляют средства для определения развивающегося пожара с помощью ручных или автоматических методов, а во-вторых, они предупреждают жителей здания о возникновении пожара и необходимости эвакуации. Другой распространенной функцией является передача сигнала уведомления о тревоге в пожарную часть или другую организацию по реагированию на чрезвычайные ситуации.Они также могут отключать электрическое оборудование, оборудование для обработки воздуха или специальные технологические операции, и они могут использоваться для запуска автоматических систем подавления. В этом разделе будут описаны основные аспекты систем обнаружения пожара и сигнализации.

Панели управления
Панель управления является «мозгом» системы обнаружения пожара и сигнализации. Он отвечает за мониторинг различных устройств ввода сигналов тревоги, таких как компоненты ручного и автоматического обнаружения, а затем за активацию устройств вывода сигналов тревоги, таких как звуковые сигналы, звонки, сигнальные лампы, устройства набора номера для экстренной связи и средства управления зданием.Панели управления могут варьироваться от простых блоков с одной зоной входа и выхода до сложных компьютерных систем, которые контролируют несколько зданий на территории всего университетского городка. Существуют две основные схемы панелей управления: обычная и адресная, которые будут рассмотрены ниже.

Обычные или «точечные» системы обнаружения пожара и сигнализации в течение многих лет были стандартным методом обеспечения аварийной сигнализации. В обычной системе одна или несколько цепей проходят через защищаемое пространство или здание.Вдоль каждой цепи размещены одно или несколько устройств обнаружения. Выбор и размещение этих детекторов зависит от множества факторов, включая необходимость автоматического или ручного запуска, температуры окружающей среды и условий окружающей среды, ожидаемого типа возгорания и желаемой скорости реакции. Один или несколько типов устройств обычно располагаются вдоль цепи для удовлетворения различных потребностей и проблем.

При возникновении пожара срабатывают один или несколько извещателей. Это действие замыкает цепь, которую пожарная панель распознает как аварийное состояние.После этого панель активирует одну или несколько сигнальных цепей для подачи сигналов тревоги в здании и вызова экстренной помощи. Панель также может отправлять сигнал на другую панель сигнализации, чтобы ее можно было контролировать с удаленной точки.

Чтобы гарантировать правильное функционирование системы, эти системы контролируют состояние каждой цепи, посылая небольшой ток по проводам. При возникновении неисправности, например, из-за обрыва проводки, этот ток не может продолжаться и регистрируется как состояние «неисправности».Индикация — необходимость обслуживания где-то на соответствующем участке цепи.

В обычной системе аварийной сигнализации все инициирование и сигнализация аварийных сигналов осуществляется аппаратным обеспечением системы, которое включает в себя несколько наборов проводов, различные реле включения и выключения и различные диоды. Благодаря такому расположению эти системы фактически являются цепями контроля и управления, а не отдельными устройствами.

Для дальнейшего объяснения этого предположим, что система пожарной сигнализации здания имеет 5 контуров, зоны от A до E, и что каждый контур имеет 10 детекторов дыма и 2 станции ручного управления, расположенные в разных комнатах каждой зоны.Возгорание огня в одной из комнат, контролируемых зоной «А», вызывает срабатывание детектора дыма. Контрольная панель пожарной сигнализации сообщит об этом как о возгорании в цепи или зоне «А». Он не будет указывать ни конкретный тип извещателя, ни его местоположение в этой зоне. Персоналу аварийного реагирования может потребоваться обыскать всю зону, чтобы определить, где устройство сообщает о пожаре. В тех случаях, когда зоны состоят из нескольких комнат или скрытых пространств, такая реакция может занять много времени и лишить ценной возможности ответа.

Преимущество обычных систем в том, что они относительно просты для зданий небольшого и среднего размера. Обслуживание не требует большого количества специализированного обучения.

Недостатком является то, что в больших зданиях их установка может быть дорогостоящей из-за большого количества проводов, необходимых для точного контроля инициирующих устройств.

Обычные системы также могут быть трудоемкими и дорогими в обслуживании. Каждое устройство обнаружения может потребовать некоторого рабочего испытания, чтобы убедиться, что оно находится в рабочем состоянии.Детекторы дыма необходимо периодически снимать, чистить и откалибровать, чтобы предотвратить неправильную работу. В обычной системе нет точного способа определения детекторов, нуждающихся в обслуживании. Следовательно, каждый детектор необходимо снимать и обслуживать, что может занять много времени, трудозатратно и дорого. Если происходит сбой, индикация «неисправности» только указывает на то, что цепь вышла из строя, но не указывает конкретно, где возникла проблема. Впоследствии технические специалисты должны обследовать всю цепь, чтобы определить проблему.

Адресные или «интеллектуальные» системы представляют собой современный уровень техники обнаружения пожара и сигнализации. В отличие от традиционных методов сигнализации, эти системы отслеживают и контролируют возможности каждого устройства инициирования и сигнализации с помощью микропроцессоров и системного программного обеспечения. По сути, каждая интеллектуальная система пожарной сигнализации представляет собой небольшой компьютер, контролирующий и управляющий рядом устройств ввода и вывода.

Как и обычная система, адресная система состоит из одной или нескольких цепей, которые излучают по всему пространству или зданию.Также, как и в стандартных системах, вдоль этих цепей может быть расположено одно или несколько устройств инициирования тревоги. Основное различие между типами систем заключается в способе мониторинга каждого устройства. В адресной системе каждому инициирующему устройству (автоматический датчик, ручная станция, переключатель расхода воды спринклера и т. Д.) Дается конкретный идентификатор или «адрес». Этот адрес соответствующим образом запрограммирован в памяти контрольной панели с такой информацией, как тип устройства, его местонахождение и конкретные детали реакции, например, какие устройства сигнализации должны быть активированы.

Микропроцессор контрольной панели посылает постоянный опрашивающий сигнал по каждой цепи, в котором с каждым инициирующим устройством связываются, чтобы узнать его статус (нормальный или аварийный). Этот активный процесс мониторинга происходит в быстрой последовательности, обеспечивая обновление системы каждые 5-10 секунд.

Адресная система также контролирует состояние каждой цепи, выявляя возможные неисправности. Одним из преимуществ, предлагаемых этими системами, является их способность конкретно определять место возникновения неисправности.Поэтому вместо того, чтобы просто показать неисправность на проводе, они укажут место проблемы. Это позволяет быстрее диагностировать неисправность и позволяет быстрее отремонтировать и вернуться в нормальное состояние.

Преимущества адресных систем сигнализации включают стабильность, улучшенное обслуживание и простоту модификации. Стабильность достигается за счет системного программного обеспечения. Если извещатель распознает состояние, которое может указывать на пожар, панель управления сначала попытается выполнить быстрый сброс.Для большинства ложных ситуаций, таких как насекомые, пыль или ветер, инцидент часто устраняется во время этой процедуры сброса, тем самым снижая вероятность ложной тревоги. Если действительно существует задымление или пожар, извещатель снова войдет в режим тревоги сразу после попытки сброса. Контрольная панель теперь расценивает это как состояние возгорания и переходит в режим тревоги.

В отношении технического обслуживания эти системы обладают несколькими ключевыми преимуществами по сравнению с обычными.Прежде всего, они могут отслеживать состояние каждого детектора. Когда детектор загрязняется, микропроцессор распознает снижение производительности и выдает предупреждение о необходимости обслуживания. Эта функция, известная как перечисленное интегральное тестирование чувствительности, позволяет обслуживающему персоналу обслуживать только те детекторы, которые требуют внимания, вместо того, чтобы требовать трудоемкой и трудоемкой очистки всех устройств.

Системы

Advanced, такие как FCI 7200, включают еще одну функцию обслуживания, известную как компенсация дрейфа.Эта программная процедура регулирует чувствительность детектора для компенсации незначительной запыленности. Это позволяет избежать сверхчувствительного или «горячего» состояния детектора, которое часто возникает из-за того, что мусор закрывает оптику детектора. Когда детектор был компенсирован до предела, панель управления предупреждает обслуживающий персонал, чтобы можно было выполнить обслуживание.

Модификация этих систем, например добавление или удаление детектора, включает в себя подключение или удаление соответствующего устройства из адресуемой цепи и изменение соответствующего раздела памяти.Это изменение памяти выполняется либо на панели, либо на персональном компьютере, при этом информация загружается в микропроцессор панели.

Основным недостатком адресных систем является то, что каждая система имеет свои уникальные рабочие характеристики. Поэтому специалисты по обслуживанию должны быть обучены работе с соответствующей системой. Программа обучения обычно представляет собой 3-4-дневный курс на предприятии соответствующего производителя. По мере разработки новых методов обслуживания может потребоваться периодическое обучение обновлению.

Пожарные извещатели
Люди могут быть отличными пожарными извещателями. Здоровый человек может ощущать несколько аспектов огня, включая жар, пламя, дым и запахи. По этой причине большинство систем пожарной сигнализации разработано с одним или несколькими устройствами ручной активации сигнализации, используемыми лицом, обнаруживающим пожар. К сожалению, человек также может быть ненадежным методом обнаружения, поскольку он может не присутствовать при возникновении пожара, может не поднять сигнал тревоги эффективным образом или может быть не в состоянии распознать признаки пожара.Именно по этой причине были разработаны различные автоматические пожарные извещатели. Автоматические детекторы предназначены для имитации одного или нескольких человеческих чувств прикосновения, обоняния или зрения. Тепловые датчики похожи на нашу способность определять высокие температуры, датчики дыма воспроизводят обоняние, а датчики пламени — это электронные глаза. Правильно подобранный и установленный автоматический извещатель может стать высоконадежным датчиком пожара.

Ручное обнаружение пожара — самый старый метод обнаружения.В простейшей форме кричащий человек может служить предупреждением о пожаре. Однако в зданиях голос человека не всегда может передаваться по всему строению. По этой причине устанавливаются станции ручной сигнализации. Общая философия дизайна заключается в размещении станций в пределах досягаемости вдоль путей эвакуации. Именно по этой причине их обычно можно встретить возле выходных дверей в коридорах и больших комнатах.

Преимущество станций ручной сигнализации состоит в том, что при обнаружении пожара они предоставляют жильцам легко идентифицируемые средства для активации системы пожарной сигнализации здания.Тогда система сигнализации может работать вместо голоса кричащего человека. Это простые устройства, которые могут быть очень надежными, когда в здании есть люди. Ключевым недостатком ручных станций является то, что они не будут работать, когда в здании нет людей. Они также могут использоваться для злонамеренных срабатываний тревог. Тем не менее, они являются важным компонентом любой системы пожарной сигнализации.

Тепловые извещатели — это старейший тип устройств автоматического обнаружения, появившийся в середине 1800-х годов, несколько стилей которого все еще производятся.Чаще всего используются устройства с фиксированной температурой, которые срабатывают, когда в помещении достигается заданная температура (обычно 135–165 ° F / 57–74 ° C). Вторым наиболее распространенным типом термодатчиков является датчик скорости нарастания температуры, который выявляет аномально быстрое повышение температуры за короткий период времени. Оба эти устройства являются детекторами «точечного типа», что означает, что они периодически размещаются вдоль потолка или высоко на стене. Третий тип детекторов — это линейный детектор с фиксированной температурой, который состоит из двух кабелей и изолированной оболочки, которая предназначена для разрушения под воздействием тепла.Преимущество линейного типа перед точечным обнаружением состоит в том, что плотность теплового считывания может быть увеличена с меньшими затратами.

Тепловые извещатели отличаются высокой надежностью и хорошей устойчивостью к срабатыванию от невосприимчивых источников. Кроме того, они очень просты и недороги в обслуживании. С другой стороны, они не работают до тех пор, пока комнатная температура не достигнет значительного значения, после чего пожар уже идет полным ходом, а ущерб растет в геометрической прогрессии. Следовательно, тепловые извещатели обычно не допускаются в приложениях, обеспечивающих безопасность жизнедеятельности.Они также не рекомендуются в местах, где есть желание идентифицировать пожар до того, как возникнет сильное пламя, например, в местах, где находится ценное термочувствительное содержимое.

Детекторы дыма — это гораздо более новая технология, получившая широкое распространение в 1970-х и 1980-х годах в жилых помещениях и в системах безопасности жизнедеятельности. Как следует из названия, эти устройства предназначены для распознавания огня на стадии тления или на ранних стадиях пламени, имитируя человеческое обоняние. Наиболее распространенными детекторами дыма являются точечные датчики, которые размещаются вдоль потолка или высоко на стенах аналогично точечным тепловым приборам.Они работают либо на ионизационном, либо на фотоэлектрическом принципе, причем каждый тип имеет преимущества в различных приложениях. Для больших открытых пространств, таких как галереи и атриумы, часто используемый детектор дыма представляет собой блок проецируемого луча. Этот детектор состоит из двух компонентов, светового излучателя и приемника, которые устанавливаются на некотором расстоянии (до 300 футов / 100 м) друг от друга. Поскольку дым мигрирует между двумя компонентами, проходящий световой луч становится прегражденным, и приемник больше не может видеть полную интенсивность луча.Это интерпретируется как состояние задымления, и сигнал активации тревоги передается на панель пожарной сигнализации.

Третий тип дымовых извещателей, который получил широкое распространение в чрезвычайно чувствительных областях, — это система аспирации воздуха. Это устройство состоит из двух основных компонентов: блока cotrol, в котором находится камера обнаружения, вытяжной вентилятор и рабочая схема; и сеть пробоотборных трубок или трубок. Вдоль трубок расположен ряд отверстий, которые позволяют воздуху попадать в трубки и транспортировать его к детектору.В нормальных условиях детектор постоянно втягивает пробу воздуха в камеру обнаружения через трубопроводную сеть. Образец анализируется на наличие дыма, а затем возвращается в атмосферу. Если в пробе появляется дым, он обнаруживается и сигнал тревоги передается на главный пульт управления пожарной сигнализацией. Детекторы аспирации воздуха чрезвычайно чувствительны и, как правило, являются самым быстрым методом автоматического обнаружения. Многие высокотехнологичные организации, такие как телефонные компании, стандартизировали системы аспирации.В культурных ценностях они используются в таких областях, как хранилища коллекций и очень ценные комнаты. Они также часто используются в эстетически чувствительных приложениях, поскольку компоненты часто легче скрыть по сравнению с другими методами обнаружения.

Ключевым преимуществом дымовых извещателей является их способность распознавать пожар, пока он еще не зародился. Таким образом, они предоставляют дополнительную возможность аварийному персоналу реагировать и контролировать развивающийся пожар до того, как произойдет серьезное повреждение.Обычно они являются предпочтительным методом обнаружения в приложениях, обеспечивающих безопасность жизнедеятельности и высокую ценность контента. Недостатком дымовых извещателей является то, что они, как правило, дороже в установке по сравнению с термодатчиками и более устойчивы к случайным срабатываниям сигнализации. Однако при правильном выборе и проектировании они могут быть очень надежными с очень низкой вероятностью ложной тревоги.

Детекторы пламени

представляют собой третий основной тип автоматического метода обнаружения и имитируют зрение человека.Это устройства прямой видимости, работающие по инфракрасному, ультрафиолетовому или комбинированному принципу. Когда возникает лучистая энергия в диапазоне приблизительно от 4000 до 7700 ангстрем, что указывает на состояние пламени, их чувствительное оборудование распознает сигнатуру огня и отправляет сигнал на панель пожарной сигнализации.

Преимущество обнаружения пламени в том, что оно чрезвычайно надежно в агрессивной среде. Они обычно используются в высокоэффективных энергетических и транспортных приложениях, где другие детекторы могут быть подвержены ложному срабатыванию.Общие области применения включают средства технического обслуживания локомотивов и самолетов, нефтеперерабатывающие заводы и платформы для загрузки топлива, а также шахты. Недостатком является то, что они могут быть очень дорогими и трудоемкими в обслуживании. Детекторы пламени должны смотреть прямо на источник пожара, в отличие от тепловых детекторов и детекторов дыма, которые могут определять мигрирующие признаки пожара. Их использование в культурных ценностях крайне ограничено.

Устройства вывода сигналов тревоги
После получения уведомления о тревоге контрольная панель пожарной сигнализации должна сообщить кому-либо о возникновении чрезвычайной ситуации.Это основная функция аспекта вывода сигнала тревоги в системе. Компоненты сигнализации присутствия включают в себя различные звуковые и визуальные компоненты оповещения и являются основными устройствами вывода сигналов тревоги. Колокола являются наиболее распространенным и привычным устройством для подачи сигналов тревоги и подходят для большинства строительных работ. Звуковые сигналы — еще один вариант, и они особенно хорошо подходят для областей, где необходим громкий сигнал, таких как стеки библиотек, и архитектурно чувствительные здания, где устройства нуждаются в частичном сокрытии.Звонки можно использовать там, где предпочтительнее тихий сигнал будильника, например, в медицинских учреждениях и в театрах. Громкоговорители — это четвертый вариант подачи сигнала будильника, который воспроизводит воспроизводимый сигнал, например, записанное голосовое сообщение. Они часто идеально подходят для больших, многоэтажных или других подобных зданий, где предпочтительна поэтапная эвакуация. Громкоговорители также предлагают дополнительную гибкость при экстренном оповещении. Что касается визуального оповещения, существует ряд стробоскопических и мигающих световых устройств.Визуальная сигнализация требуется в помещениях, где уровни окружающего шума достаточно высоки, чтобы исключить возможность использования звукового оборудования для слуха, и где могут находиться люди с нарушениями слуха. Такие стандарты, как Закон об американцах с ограниченными возможностями (ADA), требуют использования визуальных устройств во многих музейных, библиотечных и исторических зданиях.

Еще одна ключевая функция функции вывода — это уведомление об аварийном реагировании. Чаще всего используется автоматический телефон или радиосигнал, который передается в постоянно укомплектованный центр мониторинга.После получения предупреждения центр свяжется с соответствующей пожарной службой и предоставит информацию о местонахождении сигнала тревоги. В некоторых случаях станцией мониторинга может быть полиция, пожарная часть или центр 911. В других случаях это будет частная мониторинговая компания, работающая по контракту с организацией. Во многих культурных ценностях служба безопасности здания может служить центром наблюдения.

Другие выходные функции включают отключение электрического оборудования, такого как компьютеры, отключение вентиляторов для кондиционирования воздуха для предотвращения миграции дыма и отключение таких операций, как перемещение химикатов по трубам в зоне тревоги.Они также могут активировать вентиляторы для удаления дыма, что является обычной функцией в больших предсердных пространствах. Эти системы могут также активировать сброс систем газового пожаротушения или спринклерных систем предварительного срабатывания.

Сводка
В итоге, существует несколько вариантов системы обнаружения пожара и сигнализации здания. Конечный тип системы и выбранные компоненты будут зависеть от конструкции и стоимости здания, его использования или использования, типа жильцов, установленных стандартов, ценности содержимого и важности миссии.Обращение к пожарному инженеру или другому соответствующему специалисту, который разбирается в проблемах пожара и различных вариантах сигнализации и обнаружения, обычно является предпочтительным первым шагом к поиску наилучшей системы.

Спринклеры пожарные

Введение
Для большинства пожаров вода представляет собой идеальное средство тушения. В пожарных спринклерах вода используется путем прямого попадания на пламя и тепло, что вызывает охлаждение процесса горения и предотвращает возгорание соседних горючих материалов.Они наиболее эффективны на начальной стадии роста пламени, в то время как огонь относительно легко контролировать. Правильно выбранный спринклер обнаружит высокую температуру пожара, подаст сигнал тревоги и начнет подавление через несколько секунд после появления пламени. В большинстве случаев спринклеры будут контролировать распространение огня в течение нескольких минут после их активации, что, в свою очередь, приведет к значительно меньшему ущербу, чем в противном случае, если бы это произошло без спринклеров.

Среди потенциальных преимуществ спринклеров можно выделить следующие:

  • Немедленное выявление и контроль развивающегося пожара.Спринклерные системы реагируют постоянно, даже в периоды низкой загрузки. Управление обычно происходит мгновенно.
  • Немедленное предупреждение. В сочетании с системой пожарной сигнализации здания автоматические спринклерные системы будут уведомлять жителей и персонал аварийного реагирования о развивающемся пожаре.
  • Уменьшен урон от жары и дыма. При тушении пожара на ранней стадии будет образовываться значительно меньше тепла и дыма.
  • Повышенная безопасность жизни. Персонал, посетители и пожарные будут подвергаться меньшей опасности при проверке роста пожара.
  • Гибкость дизайна. Маршрут выхода и размещение противопожарных / дымовых заграждений становятся менее строгими, поскольку раннее управление огнем сводит к минимуму потребность в этих системах. Многие пожарные и строительные нормы и правила допускают гибкость проектирования и эксплуатации на основе наличия спринклерной системы пожаротушения.
  • Повышенная безопасность. Пожар, управляемый спринклерной системой, может снизить нагрузку на силы безопасности за счет сведения к минимуму возможности вторжения и кражи.
  • Снижение расходов на страхование. Пожары, контролируемые спринклерными системами, менее опасны, чем пожары в зданиях без дождя.Страховые компании могут предлагать сниженные страховые взносы на объекты, защищенные спринклерными системами.

Эти преимущества следует учитывать при выборе автоматической спринклерной противопожарной защиты.

Компоненты и принцип работы спринклерной системы
Спринклерные системы — это, по сути, серия водопроводных труб, которые снабжены надежным водоснабжением. Через определенные интервалы вдоль этих труб расположены независимые, активируемые нагреванием клапаны, известные как спринклерные головки.Распределение воды на огонь отвечает спринклер. Большинство спринклерных систем также включают в себя сигнализацию, чтобы предупредить жителей и сотрудников службы экстренной помощи при срабатывании спринклера (пожаре).

Во время начальной стадии пожара тепловая мощность относительно мала и не может вызвать срабатывание спринклера. Однако по мере увеличения интенсивности пожара чувствительные элементы спринклера подвергаются воздействию повышенных температур (обычно выше 57–107 ° C (135–225 ° F) и начинают деформироваться.Если предположить, что температура останется высокой, как это было бы во время нарастающего пожара, элемент выйдет из строя примерно через 30–120 секунд. Это освобождает уплотнения спринклера, позволяя воде стекать в огонь и начинать тушение. В большинстве случаев для борьбы с огнем требуется менее 2 спринклеров. Однако в случае быстрорастущих пожаров, таких как разлив легковоспламеняющейся жидкости, может потребоваться до 12 спринклеров.

В дополнение к обычным действиям по борьбе с пожаром, спринклерная работа может быть взаимосвязана для инициирования сигналов тревоги в здании и пожарной части, отключения электрического и механического оборудования, закрытия противопожарных дверей и заслонок и приостановки некоторых процессов.

По прибытии пожарных их усилия будут сосредоточены на том, чтобы система локализовала пожар, и, когда они будут удовлетворены, перекрыть поток воды, чтобы минимизировать ущерб от воды. Именно в этот момент персоналу обычно разрешается войти в поврежденное пространство и выполнить обязанности по спасению.

Компоненты и типы системы
Основными компонентами спринклерной системы являются спринклеры, трубопроводы системы и надежный источник воды. Для большинства систем также требуется сигнализация, системные регулирующие клапаны и средства для проверки оборудования.

Спринклер сам по себе представляет собой распылительную форсунку, которая распределяет воду по определенной пожароопасной зоне (обычно 14–21 м2 / 150–225 футов2), причем каждый спринклер работает за счет срабатывания своего собственного температурного рычага. Типичный спринклер состоит из рамы, термоуправляемого рычага, крышки, отверстия и дефлектора. Стили каждого компонента могут отличаться, но основные принципы каждого из них остаются неизменными.

  • Рама. Рама является основным конструктивным элементом, который удерживает спринклер вместе.Трубопровод подачи воды подсоединяется к оросителю в основании рамы. Рама удерживает тепловую связь и крышку на месте и поддерживает дефлектор во время разгрузки. Стили рамы включают стандартный и низкопрофильный, скрытый и скрытый монтаж. Некоторые из них предназначены для расширенного распыления, за пределами диапазона обычных спринклеров. Стандартные варианты отделки включают латунь, хром, черный и белый цвет, а индивидуальные варианты отделки доступны для эстетически чувствительных пространств. Для участков, подверженных сильному коррозионному воздействию, доступны специальные покрытия.Выбор конкретного стиля рамки зависит от размера и типа покрываемой области, ожидаемой опасности, характеристик визуального воздействия и атмосферных условий.
  • Тепловая связь. Термосвязь — это компонент, который контролирует выпуск воды. В нормальных условиях рычажный механизм удерживает крышку на месте и предотвращает протекание воды. Однако, когда звено подвергается воздействию тепла, оно ослабевает и освобождает колпачок. Обычные типы соединений включают паяные металлические рычаги, хрупкие стеклянные колбы и гранулы припоя.Каждый стиль ссылки одинаково надежен.

При достижении желаемой рабочей температуры последует задержка от 30 секунд до 4 минут. Это запаздывание является временем, необходимым для усталости рычага, и в значительной степени определяется материалами и массой рычага. Стандартные спринклеры работают ближе к отметке 3–4 минуты, в то время как спринклеры быстрого реагирования (QR) работают в значительно более короткие периоды. Выбор характеристики отклика спринклера зависит от существующего риска, приемлемого уровня потерь и желаемого ответного действия.

В традиционных применениях преимущество спринклеров с быстрым срабатыванием часто становится очевидным. Чем быстрее спринклер среагирует на возгорание, тем раньше будут инициированы действия по тушению пожара и тем ниже будет уровень потенциального ущерба. Это особенно полезно в приложениях с высокой стоимостью или безопасностью жизни, где как можно более раннее тушение является целью противопожарной защиты. Важно понимать, что время отклика не зависит от температуры отклика. Спринклер с более быстрым откликом не сработает при более низкой температуре, чем сопоставимая стандартная головка.

  • Колпачок. Колпачок обеспечивает водонепроницаемое уплотнение, которое находится над отверстием спринклера. Он удерживается на месте термической связью и опускается из положения после нагревания рычага, чтобы пропустить воду. Колпачки изготавливаются исключительно из металла или металла с тефлоновым диском.
  • Отверстие. Обработанное отверстие в основании рамы спринклера — это отверстие, через которое течет вода для пожаротушения. Большинство отверстий имеют диаметр 15 мм (1/2 дюйма) с меньшими отверстиями, доступными для жилых помещений, и большими отверстиями для более высоких опасностей.
  • Дефлектор. Дефлектор установлен на раме напротив отверстия. Его цель — разбить струю воды, выходящую из отверстия, на более эффективную схему тушения. Типы дефлекторов определяют способ монтажа спринклера: распространенные способы монтажа спринклера известны как вертикальные (устанавливаются над трубой), подвесные (устанавливаются под трубой, то есть под потолком) и спринклеры на боковых стенках, которые сбрасывают воду в боковом положении от стены. Спринклер должен быть установлен в соответствии с конструкцией, чтобы обеспечить надлежащее действие.Выбор определенного стиля часто зависит от физических ограничений здания.

Спринклер с функцией включения / выключения, который вызвал большой интерес у музейных приложений. Принцип, лежащий в основе этих продуктов, заключается в том, что при возникновении пожара сброс воды и тушение будут происходить аналогично стандартным спринклерам. Когда температура в помещении снижается до более безопасного уровня, биметаллический стопорный диск на спринклерной системе закрывается, и поток воды прекращается. Если возгорание возгорается, снова включается работа.Преимущество двухпозиционных спринклеров заключается в их способности отключаться, что теоретически может уменьшить количество распределяемой воды и, как следствие, уровень повреждений. Проблема, однако, заключается в том, что может пройти долгий период времени, прежде чем комнатная температура достаточно снизится до точки отключения спринклера. В большинстве случаев, когда речь идет о наследии, конструкция здания будет сохранять тепло и предотвращать отключение спринклера. Часто силы пожарного реагирования прибывают и смогут закрыть регулирующие клапаны спринклерной зоны до того, как сработает функция автоматического отключения.

Двухпозиционные спринклеры обычно стоят в 8–10 раз больше, чем обычные спринклеры, что оправдано только в том случае, если можно гарантировать, что эти продукты будут работать так, как задумано. Таким образом, использование спринклерных систем включения / выключения на объектах культурного наследия должно оставаться ограниченным.

Выбор конкретных спринклеров основан на: характеристиках риска, температуре окружающей среды, желаемом времени реакции, критичности опасности и эстетических факторах. В объекте наследия можно использовать несколько типов спринклерных оросителей.

Для всех спринклерных систем требуется надежный источник воды. В городских районах водопроводные коммунальные услуги являются наиболее распространенным источником снабжения, в то время как в сельских районах обычно используются частные резервуары, водохранилища, озера или реки. Если требуется высокая степень надежности или один источник не является надежным, можно использовать несколько источников.

Основные критерии источника воды включают:

  • Источник должен быть доступен в любое время. Пожары могут случиться в любой момент, поэтому водопровод должен быть в постоянной готовности.Поставки должны быть оценены на устойчивость к выходу из строя труб, потере давления, засухе и другим проблемам, которые могут повлиять на доступность.
  • Система должна обеспечивать адекватную подачу и давление спринклера. Спринклерная система создает потребность в гидравлической системе подачи воды с точки зрения расхода и давления. Предложение должно быть способно удовлетворить этот спрос. В противном случае в систему необходимо добавить дополнительные компоненты, такие как пожарный насос или резервный резервуар.
  • Водоснабжение должно обеспечивать воду на предполагаемую продолжительность пожара.В зависимости от пожарной опасности тушение может занять от нескольких минут до более часа. Выбранный источник должен обеспечивать подачу воды в разбрызгиватели до тех пор, пока не будет достигнуто подавление.
  • Система должна обеспечивать водой пожарные шланги, работающие в тандеме с спринклерной системой. Большинство процедур пожарной охраны включают использование пожарных шлангов в дополнение к спринклерам. Водоснабжение должно быть способно удовлетворить этот дополнительный спрос без отрицательного воздействия на работу спринклера.

Спринклерная вода транспортируется к месту пожара по системе стационарных труб и фитингов. Варианты материалов трубопроводов включают различные стальные сплавы, медь и огнестойкие пластмассы. Сталь — это традиционный материал, а медь и пластмасса используются во многих чувствительных областях. Основные соображения при выборе материалов для труб включают:

  • Простота установки. Чем проще устанавливается материал, тем меньше сбоев в работе и миссии учреждения.Возможность установить систему с наименьшим количеством помех является важным фактором, особенно при модернизации спринклерных систем, когда использование здания будет продолжаться во время строительства.
  • Стоимость материалов по сравнению со стоимостью охраняемой территории. Трубопроводы обычно представляют собой самую большую статью затрат в спринклерной системе. Часто возникает соблазн снизить затраты за счет использования менее дорогих материалов для трубопроводов, которые могут быть вполне приемлемыми в определенных случаях, т.е.е. офисные или коммерческие помещения. Однако в традиционных приложениях, где ценность содержимого может быть далеко за пределами затрат на спринклерные системы, решающим фактором должно быть соответствие трубопровода, а не стоимость.
  • Ознакомление подрядчика с материалами. Следует избегать ошибки, при которой подрядчик и материалы трубы были выбраны только для того, чтобы обнаружить, что подрядчик не имеет опыта работы с трубой. Это может привести к трудностям при установке, дополнительным расходам и увеличению вероятности отказа.Подрядчик должен продемонстрировать знакомство с желаемым материалом перед выбором.
  • Предварительные требования к изготовлению или другие ограничения при установке. В некоторых случаях, например, в хранилищах изобразительного искусства, могут быть наложены требования, ограничивающие количество рабочего времени в помещении. Это часто требует обширных сборных работ за пределами рабочей зоны. Некоторые материалы легко адаптируются к заводскому изготовлению.
  • Чистота материалов. Некоторые материалы труб устанавливать чище, чем другие.Это снизит вероятность загрязнения коллекций, дисплеев или отделки здания во время установки. Различные материалы также устойчивы к накоплению в системе воды, которая может стекать в сборники. Следует учитывать чистоту установки и слива.
  • Требования к персоналу. Некоторые материалы труб тяжелее или более громоздки в работе, чем другие. Следовательно, для установки труб требуются дополнительные рабочие, что может увеличить затраты на установку.Если количество строительных рабочих, допущенных в здание, является фактором, более легкие материалы могут быть полезны.

Преимущества и недостатки каждого материала должны быть оценены до выбора материала трубы.

Другие основные компоненты спринклерной системы:

  • Регулирующие клапаны. Спринклерная система должна быть способна отключаться после устранения пожара, а также для периодического обслуживания и модификации. В простейшей системе один запорный клапан может быть расположен в точке, где вода поступает в здание.В больших зданиях спринклерная система может состоять из нескольких зон с регулирующим клапаном для каждой. Регулирующие клапаны должны быть расположены в легко идентифицируемых местах, чтобы помочь персоналу, оказавшему помощь в чрезвычайных ситуациях.
  • Тревоги. Сигнализация предупреждает жителей здания и сотрудников службы экстренной помощи при возникновении потока воды из спринклера. Самая простая сигнализация — это гонги с водяным приводом, которые питаются от спринклерной системы. Электрические реле расхода и давления, подключенные к системе пожарной сигнализации здания, чаще встречаются в больших зданиях.Также предусмотрена сигнализация, чтобы предупредить руководство здания о закрытии спринклерного клапана.
  • Сливные и контрольные соединения. В большинстве спринклерных систем предусмотрены дренажные трубы во время технического обслуживания системы. Дренажные системы должны быть правильно установлены, чтобы удалить всю воду из спринклерной системы и предотвратить утечку воды в защищенные помещения, когда необходимо обслуживание трубопроводов. Рекомендуется установить сливы в удаленном от источника питания месте, чтобы обеспечить эффективную промывку системы для удаления мусора.Тестовые соединения обычно используются для имитации потока спринклера, тем самым проверяя рабочее состояние аварийных сигналов. Контрольные соединения следует запускать каждые 6 месяцев.
  • Специальные клапаны. Drypipe и спринклерные системы предварительного срабатывания требуют сложных специальных регулирующих клапанов, которые предназначены для удержания воды из трубопроводов системы до тех пор, пока она не понадобится. Эти регулирующие клапаны также включают оборудование для поддержания давления воздуха и системы аварийного срабатывания / сброса.
  • Соединения пожарного рукава. Пожарные часто дополняют спринклерные системы шлангами. Задачи пожаротушения улучшаются за счет установки шланговых соединений на трубопровод спринклерной системы. Дополнительная потребность в воде, вызванная этими шлангами, должна быть учтена в общей конструкции спринклера, чтобы предотвратить ухудшение работы системы.

Типы систем

Существует три основных типа спринклерных систем: мокрая труба, сухая труба и предварительное срабатывание, каждая из которых применима в зависимости от множества условий, таких как потенциальная интенсивность пожара, ожидаемая скорость роста пожара, чувствительность к содержанию воды, условия окружающей среды и желаемый ответ. .В больших многофункциональных помещениях, таких как крупный музей или библиотека, можно использовать два или более типа систем.

Системы влажных труб являются наиболее распространенными спринклерными системами. Как следует из названия, система влажных труб — это система, в которой вода постоянно поддерживается внутри спринклерного трубопровода. При срабатывании спринклера эта вода сразу же сливается в огонь. Преимущества системы влажных труб:

  • Простота и надежность системы. Спринклерные системы с влажной трубой имеют наименьшее количество компонентов и, следовательно, наименьшее количество неисправных элементов.Это обеспечивает непревзойденную надежность, что важно, поскольку спринклеры могут ждать долгие годы, прежде чем они потребуются. Этот аспект простоты также становится важным на объектах, где обслуживание системы не может выполняться с желаемой частотой.
  • Относительно низкие затраты на установку и обслуживание. Благодаря своей общей простоте, дождеватели с мокрыми трубами требуют наименьших затрат времени и средств на установку. Также достигается экономия затрат на техническое обслуживание, поскольку обычно требуется меньше времени на обслуживание по сравнению с другими типами систем.Эта экономия становится важной, когда сокращаются бюджеты на техническое обслуживание.
  • Легкость модификации. Исторические учреждения часто бывают динамичными в отношении выставочных и операционных помещений. Системы влажных трубопроводов имеют преимущество, поскольку модификации включают отключение водоснабжения, слив труб и внесение изменений. По окончании работ система опрессовывается и восстанавливается. Исключается дополнительная работа по обнаружению и специальному контролю, что снова экономит время и деньги.
  • Кратковременный простой после пожара. Спринклерные системы с мокрыми трубами требуют наименьших усилий для восстановления. В большинстве случаев защита спринклера восстанавливается путем замены спринклеров с предохранителем и повторного включения подачи воды. Системы предварительного срабатывания и сухие трубы могут потребовать дополнительных усилий для сброса контрольного оборудования.

Основным недостатком этих систем является то, что они не подходят для сред с низкими температурами замерзания. Также могут возникнуть опасения, если трубопроводы могут быть серьезно повреждены при ударе, например, на некоторых складах.

Преимущества влажных систем делают их очень востребованными для использования в большинстве приложений наследия, и, за ограниченным исключением, они представляют собой систему выбора для защиты музеев, библиотек и исторических зданий.

Следующий тип системы, спринклерная система с сухими трубами, — это система, в которой трубы заполнены сжатым воздухом или азотом, а не водой. Этот воздух удерживает дистанционный клапан, известный как клапан с сухой трубкой, в закрытом положении. Клапан drypipe расположен в нагретой зоне и предотвращает попадание воды в трубу до тех пор, пока пожар не вызовет срабатывание одного или нескольких спринклеров.Как только это произойдет, воздух уйдет и откроется клапан с сухой трубкой. Затем вода попадает в трубу и через открытые спринклеры попадает в огонь.

Основным преимуществом спринклерных систем с сухими трубами является их способность обеспечивать автоматическую защиту в помещениях, где возможно замерзание. Типичные установки с сухими трубами включают неотапливаемые склады и чердаки, открытые погрузочные доки и внутри коммерческих морозильных камер.

Многие менеджеры по наследству считают спринклеры с сухими трубами выгодными для защиты коллекций и других чувствительных к воде участков, с очевидным преимуществом, заключающимся в том, что из физически поврежденной системы влажных труб будет протекать, а в системах с сухими трубами — нет.Однако в этих ситуациях системы с сухими трубами, как правило, не имеют никаких преимуществ перед системами с мокрыми трубами. Если произойдет ударное повреждение, произойдет только небольшая задержка нагнетания, то есть 1 минута, в то время как воздух из трубопровода будет выпущен раньше, чем поток воды.

Системы с сухими трубами имеют некоторые недостатки, которые необходимо оценить перед выбором этого оборудования. К ним относятся:

  • Повышенная сложность. Системы с сухими трубами требуют дополнительного оборудования управления и компонентов подачи воздуха, что увеличивает сложность системы.Без надлежащего обслуживания это оборудование может быть менее надежным, чем сопоставимая система влажных трубопроводов.
  • Более высокие затраты на установку и обслуживание. Дополнительная сложность влияет на общую стоимость установки сухой трубы. Эта сложность также увеличивает расходы на техническое обслуживание, в первую очередь из-за дополнительных затрат на рабочую силу.
  • Более низкая гибкость конструкции. Существуют строгие требования в отношении максимально допустимого размера (обычно 750 галлонов) отдельных систем сухих труб.Эти ограничения могут повлиять на способность владельца вносить дополнения в систему.
  • Увеличено время реакции на пожар. Может пройти до 60 секунд с момента открытия спринклера до того, как вода начнет сливаться в огонь. Это приведет к задержке действий по тушению пожара, что может привести к повышенному повреждению содержимого.
  • Повышенный потенциал коррозии. После эксплуатации спринклерные системы drypipe должны быть полностью осушены. В противном случае оставшаяся вода может вызвать коррозию трубы и преждевременный выход из строя.Это не проблема для влажных трубопроводных систем, в которых вода постоянно поддерживается в трубопроводе.

За исключением неотапливаемых помещений и морозильных камер, системы с сухими трубами не обладают значительными преимуществами по сравнению с системами с мокрыми трубами, и их использование в исторических зданиях, как правило, не рекомендуется.

Третий тип спринклерных систем, предварительное срабатывание, использует базовую концепцию системы сухих труб, заключающуюся в том, что вода обычно не содержится в трубах. Однако разница в том, что вода удерживается из трубопровода с помощью клапана с электрическим приводом, известного как клапан предварительного срабатывания.Работа этого клапана контролируется независимым датчиком пламени, тепла или дыма. Для срабатывания спринклера должны произойти два отдельных события. Сначала система обнаружения должна идентифицировать развивающийся пожар, а затем открыть клапан предварительного срабатывания. Это позволяет воде течь в трубопровод системы, что эффективно создает спринклерную систему влажных труб. Во-вторых, отдельные спринклерные головки должны высвободиться, чтобы вода попала в огонь.

В некоторых случаях система предварительного срабатывания может быть оснащена функцией блокировки, при которой в трубопровод системы добавляется сжатый воздух или азот.Эта функция имеет двоякую цель: во-первых, контролировать трубопровод на предмет утечек, а во-вторых, удерживать воду из трубопроводов системы в случае непреднамеренного срабатывания детектора. Чаще всего этот тип системы применяется на морозильных складах.

Основным преимуществом системы предварительного срабатывания является двойное действие, необходимое для выпуска воды: клапан предварительного срабатывания должен срабатывать, а спринклерные головки должны плавиться. Это обеспечивает дополнительный уровень защиты от непреднамеренного разряда, и по этой причине эти системы часто используются в чувствительных к воде средах, таких как архивные хранилища, хранилища произведений искусства, библиотеки раритета и компьютерные центры.

У систем предварительного срабатывания есть некоторые недостатки. К ним относятся:

  • Более высокие затраты на установку и обслуживание. Системы предварительного срабатывания более сложны с несколькими дополнительными компонентами, в частности, системой обнаружения пожара. Это увеличивает общую стоимость системы.
  • Сложности модификации. Как и системы сухих труб, спринклерные системы предварительного срабатывания имеют определенные ограничения по размеру, которые могут повлиять на будущие модификации системы. Кроме того, модификации системы должны включать изменения в систему обнаружения и управления возгоранием для обеспечения надлежащей работы.
  • Возможное снижение надежности. Более высокий уровень сложности, связанный с системами предварительного срабатывания, увеличивает вероятность того, что что-то может не работать, когда это необходимо. Регулярное обслуживание необходимо для обеспечения надежности. Следовательно, если руководство предприятия решит установить защиту от спринклера предварительного срабатывания, оно должно оставаться приверженным установке оборудования высочайшего качества и обслуживанию этих систем в соответствии с рекомендациями производителя.

Системы предварительного срабатывания, при условии подходящего применения, могут использоваться в исторических зданиях, особенно в помещениях, чувствительных к воде.

Небольшая разновидность спринклеров предварительного срабатывания — дренчерная система, которая в основном представляет собой систему предварительного срабатывания с использованием открытых спринклеров. При срабатывании системы обнаружения пожара открывается дренчерный клапан, который, в свою очередь, обеспечивает немедленный поток воды через все спринклеры в данной области. Типичные применения дренчерных систем можно найти в специализированных промышленных ситуациях, например, в подвесных сооружениях самолетов и на химических заводах, где необходимо подавление высоких скоростей для предотвращения распространения огня. Использование дренчерных систем на объектах наследия редко и обычно не рекомендуется.

Другой вариант системы предварительного срабатывания — это система включения / выключения, в которой используется базовая компоновка системы предварительного срабатывания, с добавлением теплового детектора и незафиксирующей панели сигнализации. Система функционирует аналогично любой другой спринклерной системе с предварительным срабатыванием, за исключением того, что при тушении огня тепловое устройство охлаждает, чтобы панель управления перекрывала поток воды. Если огонь возобновится, система снова включится. В некоторых приложениях могут быть эффективны системы включения / выключения. Однако при выборе этого оборудования необходимо проявлять осторожность, чтобы обеспечить его надлежащую работу.В большинстве городских районов вполне вероятно, что пожарная часть прибудет до того, как система отключится, тем самым сводя на нет любые реальные преимущества.

Проблемы, связанные с дождевателями

Существует несколько распространенных заблуждений о спринклерных системах. Следовательно, владельцы и операторы исторических зданий часто неохотно предоставляют такую ​​защиту, особенно для хранилищ коллекций и других чувствительных к воде мест. Типичные недоразумения включают:

  • Когда работает один дождеватель, активируются все. За исключением дренчерных систем (обсуждаемых далее в этой брошюре), реагируют только те спринклеры, которые находятся в прямом контакте с теплом огня. По статистике, примерно 61% всех пожаров, контролируемых спринклерными системами, тушатся двумя или менее спринклерами.
  • Спринклеры работают под воздействием дыма. Спринклеры работают за счет теплового удара по чувствительным элементам. Наличие дыма само по себе не вызовет активации без сильного нагрева.
  • Спринклерные системы подвержены утечкам или непреднамеренному срабатыванию.Статистика страхования указывает на частоту отказов примерно 1 головки на 16 000 000 установленных спринклеров в год. Компоненты и системы дождевателей являются одними из самых проверенных систем в обычном здании. Отказ надлежащей системы очень отдаленный. Если отказы случаются, они обычно являются результатом неправильного проектирования, установки или обслуживания. Поэтому, чтобы избежать проблем, учреждение должно тщательно выбирать тех, кто будет нести ответственность за установку и заниматься надлежащим обслуживанием системы.
  • Активация спринклера приведет к чрезмерному повреждению водой содержимого и конструкции. При срабатывании спринклера возникнет повреждение водой. Однако эта проблема становится относительной по сравнению с альтернативными методами подавления. Типичный спринклер будет пропускать примерно 25 галлонов в минуту (галлонов в минуту), в то время как типичный пожарный шланг подает 100–250 галлонов в минуту. Спринклеры значительно менее опасны, чем шланги. Поскольку спринклеры обычно срабатывают до того, как пожар станет большим, общее количество воды, необходимое для борьбы с ним, меньше, чем в ситуациях, когда пожар продолжает усиливаться до прибытия пожарных.

В таблице ниже приведены приблизительные сравнительные нормы расхода воды для различных ручных и автоматических методов подавления.

Таблица 31: Нормы расхода воды для пожаротушения

Способ доставки литров / мин. галлонов / мин.
Переносной огнетушитель / прибор 10 2.5
Пожарный шланг для людей 380 100
Ороситель (1) 95 25
Ороситель (2) 180 47
Ороситель (3) 260 72
Пожарная часть, одинарный шланг 1,5 380 100
Пожарная часть, двойная 1.5 шланг 760 200
Пожарная часть, одинарный шланг 2,5 950 250
Пожарная часть, двойной шланг 2,5 1900 500

Последний момент, который следует учитывать, заключается в том, что повреждение, нанесенное водой, обычно можно исправить и восстановить. Однако сгоревшее содержимое часто не подлежит ремонту.

  • Спринклерные системы плохо выглядят и могут испортить внешний вид здания. Это беспокойство обычно возникает из-за того, что кто-то наблюдал неидеальную внешнюю систему, и, по общему признанию, существуют некоторые плохо спроектированные системы. Спринклерные системы могут быть спроектированы и установлены практически без эстетических последствий.

Чтобы обеспечить надлежащий дизайн, организация и команда разработчиков должны играть активную роль в выборе видимых компонентов. Трубопровод дождевателя должен быть скрытым или декоративным, чтобы свести к минимуму визуальное воздействие.Следует использовать только спринклеры с высококачественной отделкой. Часто производители спринклерных систем используют краски, предоставленные заказчиком, чтобы соответствовать цвету отделки, сохраняя при этом список спринклера. Выбранный подрядчик по спринклерной установке должен понимать роль эстетики.

Чтобы обеспечить общий успех, разработчик спринклерной системы должен понимать цели защиты, операции и риски возникновения пожара в организации. Этот человек должен быть осведомлен о системных требованиях и быть гибким, чтобы внедрять уникальные продуманные решения для тех областей, где существуют особые эстетические или операционные проблемы.Разработчик должен иметь опыт проектирования систем в архитектурно чувствительных приложениях.

В идеале подрядчик по дождеванию должен иметь опыт работы с объектами наследия. Однако можно выбрать подрядчика, имеющего опыт работы в чувствительных к воде приложениях, таких как телекоммуникации, фармацевтика, чистые помещения или высокотехнологичное производство. Такие компании, как AT&T, Bristol Meyers Squibb и IBM, предъявляют очень строгие требования к установке спринклерных систем. Если подрядчик по дождеванию продемонстрировал успех в таких организациях, то они смогут удовлетворительно работать на объекте наследия.

Выбранные компоненты спринклера должны быть предоставлены надежным производителем, имеющим опыт работы в особых, чувствительных к воде опасностях. Разница в стоимости компонентов среднего и высшего качества минимальна. Однако долгосрочная выгода существенна. При рассмотрении стоимости объекта и его содержимого дополнительные вложения окупаются.

При должном внимании к выбору, проектированию и техническому обслуживанию спринклерные системы будут служить учреждению без неблагоприятных последствий.Если учреждение или команда разработчиков не обладают опытом, чтобы гарантировать, что система работает надлежащим образом, инженер по противопожарной защите, имеющий опыт работы с традиционными приложениями, может быть большим преимуществом.

Water Mist
Одной из наиболее многообещающих технологий автоматического пожаротушения является недавно появившаяся система капель воды или тумана. Эта технология представляет собой еще один инструмент, который может обеспечить автоматическое тушение пожара в некоторых областях применения культурных ценностей. Возможные варианты использования включают в себя места, где нет надежного водоснабжения, где расход воды даже из спринклерных систем слишком велик или где конструкция и внешний вид здания влияют на использование стандартных размеров спринклерных труб.Системы тумана также могут быть подходящим решением проблемы защиты, оставленной экологическими проблемами и последующим прекращением использования газа галона 1301.

Технология

Mist изначально была разработана для использования на шельфе, например, на борту судов и нефтяных буровых платформ. Для обоих этих применений существует потребность в борьбе с серьезными пожарами при ограничении количества воды для тушения, которая может повлиять на устойчивость судна. Эти системы были широко одобрены рядом национальных и международных морских организаций и были стандартом защиты на протяжении последних 8–10 лет.У них солидный опыт борьбы с морскими пожарами. Эти системы также использовались в нескольких наземных приложениях и имеют ряд списков, главным образом в Европе, где их эффективность была признана. Некоторые системы недавно получили одобрение для использования на суше в Северной Америке.

Системы тумана сбрасывают ограниченное количество воды при более высоком давлении, чем спринклерные системы. Эти давления находятся в диапазоне приблизительно от 100 до 1000 фунтов на квадратный дюйм, при этом системы с более высоким давлением обычно производят большие объемы тонкодисперсных распылителей.Образующиеся капли обычно имеют диаметр от 50 до 200 микрон (по сравнению с 600–1000 микрон для стандартных спринклеров), что приводит к исключительно высокому эффективному охлаждению и контролю над пожаром при значительно меньшем количестве воды. В большинстве случаев для борьбы с пожарами используется примерно 10-25% воды, обычно используемой для разбрызгивателей. Снижается водонасыщенность, часто связанная со стандартными процедурами пожаротушения. Другие преимущества включают меньшее эстетическое воздействие и известную экологическую безопасность.

Типичные системы водяного тумана состоят из следующих компонентов:

  • Водоснабжение: Вода для системы может подаваться либо из трубопроводной системы здания, либо из специального резервуара. В некоторых случаях в системах с более низким давлением могут использоваться существующие спринклерные трубопроводы. Однако для большинства потребуются дополнительные насосы. Другие варианты включают специальные баллоны для хранения воды / азота, которые могут обеспечивать ограниченный срок службы.
  • Трубопроводы и форсунки: Трубопроводы можно значительно уменьшить по сравнению с спринклерами.Для систем низкого давления трубы обычно на 25-50% меньше, чем сопоставимые спринклерные трубы. Для систем высокого давления размер трубопровода еще меньше — обычно диаметр 0,50–0,75 дюйма. Как и спринклеры, форсунки индивидуально активируются теплом огня и выбираются таким образом, чтобы покрыть опасность определенного размера. Их размеры сопоставимы с низкопрофильным оросителем.
  • Оборудование для обнаружения и контроля: В некоторых случаях выброс тумана может контролироваться выбранными высоконадежными интеллектуальными детекторами или передовой технологической системой обнаружения дыма VESDA.Эти системы представляют собой передовую современную технологию обнаружения пожара, которая может обеспечить очень раннее предупреждение о развивающемся пожаре, а также снизить вероятность непреднамеренного разряда.

На данный момент одним из основных недостатков туманных систем является их более высокая стоимость, которая может быть на 50–100% выше, чем у стандартных спринклеров. Однако эта стоимость может быть уменьшена за счет возможной экономии трудозатрат при установке. В сельской местности, где надежные спринклерные системы водоснабжения могут быть дорогими, системы туманообразования могут быть сопоставимы со стандартными спринклерами или меньше их.Другая проблема заключается в том, что эти системы не имеют множества разрешений и списков, обычно связанных с дождевателями. Как таковые, они могут быть не признаны пожарными и строительными органами. Кроме того, количество подрядчиков, знакомых с технологией, ограничено. Однако эти опасения уменьшаются по мере того, как использование этих систем становится все более распространенным.

Резюме
Таким образом, автоматические спринклеры часто представляют собой один из наиболее важных вариантов противопожарной защиты для большинства традиционных применений.Успешное применение спринклеров зависит от тщательного проектирования и установки высококачественных компонентов квалифицированными инженерами и подрядчиками. Правильно подобранная, спроектированная и установленная система обеспечит непревзойденную надежность. Компоненты спринклерной системы следует выбирать в соответствии с целями учреждения. Системы мокрых труб обеспечивают высочайшую степень надежности и являются наиболее подходящим типом системы для большинства случаев возгорания, возникшего в результате традиционного пожара. За исключением помещений, подверженных замораживанию, системы с сухими трубами не имеют преимуществ перед системами с мокрыми трубами в исторических зданиях.Спринклерные системы с предварительным срабатыванием полезны в областях с наибольшей чувствительностью к воде. Их успех зависит от выбора надлежащих компонентов подавления и обнаружения и приверженности руководства надлежащему обслуживанию систем. Водяной туман представляет собой очень многообещающую альтернативу системам газообразных агентов.

Дополнительная информация

Для выбора пожарных спринклерных систем доступны следующие источники информации:

  • Сеть пожарной безопасности; Почтовый ящик 895; Мидлбери, Вермонт, 05753; СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ.Телефон: (802) 388-1064. Электронная почта: [email protected]
  • Национальная ассоциация противопожарной защиты; Batterymarch Park; Quincy, Massachusetts 02269; СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ. Телефон: (617) 770-3000. http://www.nfpa.org.
  • Reliable Automatic Sprinkler, Inc .; 525 North MacQuesten Parkway, Маунт-Вернон, Нью-Йорк 10552 США. Телефон: (800) 668-3470. Внимание: г-жа Кэти Слэк, менеджер по маркетингу. http://www.reliablesprinkler.com.
  • Приборы управления огнем; 301 Second Street, Уолтем, Массачусетс, 02154.Телефон: (781) 487-0088. Внимание: мистер Рэнди Эдвардс.


Автор Ник Артим

Attribution-NonCommercial-NoDerivs
CC BY-NC-ND

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *