Грунтовка концентрированная: Грунтовка-концентрат купить по низким ценам

Содержание

Грунтовка ЕК G100 10л концентрированная для внутренних и наружных работ

Грунтовка ЕК на акриловой основе предназначена для обработки пористых минеральных оснований (бетон, гипс, дерево, кирпич, гипсокартон, цементные и гипсовые штукатурки) с целью снижения впитывающей способности, связывания пыли, остатков побелки, улучшения адгезии и снижения расхода обойного клея и т.д. Грунтовка может применяться перед устройством наливных полов, тонкослойным оштукатуриванием, шпатлеванием.

Грунтовка предназначена для внутренних и наружных работ

Подробные технические характеристики грунтовки ЕК G100:

Основа грунтовки: акрил

Расход: 70-120 мл/м2

Температура проведения работ: от +5 до +30 

Температура эксплуатации: от -50 до +70 

Стойкость к переменному замораживанию/оттаиванию не менее 30 циклов

Замораживание при температуре минус (18±3) °С не более 36 суток

Срок годности в неповрежденной оригинальной упаковке: 6 месяцев со дня изготовления

Особенности грунтовки ЕК G 100
  • Грунтовка снижает расход лакокрасочных материалов, связывает пыль, остатки побелки и увеличивает адгезию

 

Подготовка основания для грунтования

Температура основания должна быть не ниже +5 ºС.

Поверхность основания должна быть сухой, твердой, тщательно очищенной от пыли, грязи, масел и других загрязнений и отслаивающихся материалов.

Нанесение грунтовки на основу

Грунтовка является концентрированным раствором (рекомендуется разводить чистой водой в пропорции 1:2). Работы необходимо проводить при температуре не ниже +5 ºС. Грунтовка наносится на поверхность кистью, валиком или распылителем. Средний расход грунтовки составляет 70-120 мл/м2. Для получения наилучшего результата после высыхания первого слоя по истечении 40-90 минут рекомендуется нанести второй слой.

Техника безопасности

Концентрированная грунтовка ЕК G100 (10л) не содержит растворителей. При работе соблюдать меры индивидуальной безопасности, при попадании в глаза промыть большим количеством воды.

Гарантии и хранение

Срок годности грунтовки в неповрежденной оригинальной упаковке – 6 месяцев со дня изготовления. Хранить грунтовку в помещениях при температуре не ниже +5 ºС. Стойкость к замораживанию/размораживанию при хранении не менее 30 циклов. Продолжительное замораживание при температуре минус (18±3) ºС не более 36 суток.

Состав концентрированной грунтовки: Водная дисперсия стирол-акрилатов.

Профессиональные материалы для укладки напольных покрытий homakoll.

Ремонт собственными руками

Профессиональный ремонт

Большое количество различных клеевых материалов для проведения ремонтных и строительных работ. В этом разделе каталога представлены продукты, которые подойдут как для мелкого домашнего ремонта своими руками.

В этом разделе каталога представлены продукты, которые подойдут как для мелкого домашнего ремонта своими руками, так и для использования профессиональными строительными бригадами на коммерческих объектах.

на страницу с материалами на страницу с материалами

 

 

Современная жизнь требует новых материалов, инновационных разработок, и в основе большинства этих процессов лежат химические технологии, обеспечивающие связь между наукой и производством.
Группа ХОМА — современный химический холдинг, в состав которого входят: предприятия по производству полимерных дисперсий, клеевых и лакокрасочных систем для различных областей применения; научно-исследовательские и испытательные центры, направленные как на улучшение свойств готовых продуктов, так и на разработку новых продуктов, технологий и методов их исследования.

Наша специализация — Сhemical Engineering — химические технологии. Технологии как искусство превращения и модификации свойств сырья и материалов. Искусство создания продуктов с заданными функциональными свойствами. Группа ХОМА стремится быть первой на рынке промышленной и строительной химии, поэтому приоритетное значение мы отдаем развитию собственного научного потенциала, новым химическим разработкам, усовершенствованию технологических процессов, контролю менеджмента качества.
Мы идем в ногу со временем, работая в области экономичных и экологичных, безвредных для человека и окружающей среды, продуктов. Мы создаем новые уникальные решения в тех областях, в которых являемся специалистами.

 

ТД Стройматериалы — Универсальная грунтовка (концентрированная) ЕК G100

ГРУНТОВКА УНИВЕРСАЛЬНАЯ КОНЦЕНТРИРОВАННАЯ ЕК G100

Грунтовка на акриловой основе EK G100 предназначена для обработки пористых минеральных оснований (бетон, гипс, дерево, кирпич, гипсокартон, цементные и гипсовые штукатурки) с целью снижения впитывающей способности, связывания пыли, остатков побелки, улучшения адгезии и снижения

Для внутренних и наружных работ.

Особенности

  • Снижает расход лакокрасочных материалов
  • Связывает пыль, остатки побелки
  • Увеличивает адгезию

 

Технические характеристики

Состав водная дисперсия стирол-акрилатов
Основа акрил
Расход, мл/м² 70-120
Температура проведения работ, °С
от +5 до +30
Температура эксплуатации, °С от -50 до +70
Стойкость к замораживанию/оттаиванию при хранении не менее, циклов 30
Замораживание при температуре минус (18±3) °С не более, суток 36
Срок годности в неповрежденной оригинальной упаковке 6 месяцев со дня изготовления
  • Инструкция

    Подготовка основания

    Температура основания должна быть не ниже +5°С. Поверхность основания должна быть сухой, твердой, тщательно очищенной от пыли, грязи, масел и других загрязнений и отслаивающихся материалов.

    Нанесение на основу

    Продукт является концентрированным раствором (рекомендуется разводить чистой водой в пропорции 1:2). Работы необходимо проводить при температуре не ниже +5°С. Грунтовка наносится на поверхность кистью, валиком или распылителем. Средний расход составляет 70-120 мл/м². Для получения наилучшего результата после высыхания первого слоя по истечении 40-90 минут рекомендуется нанести второй слой.

  • Техника безопасности

    Продукт не содержит растворителей. При работе соблюдать меры индивидуальной безопасности, при попадании в глаза промыть большим количеством воды.

  • Гарантии и хранение

    Срок годности в неповрежденной оригинальной упаковке – 6 месяцев со дня изготовления. Хранить в помещениях при температуре не ниже +5°С. Стойкость к замораживанию/размораживанию при хранении не менее 30 циклов. Продолжительное замораживание при температуре минус (18±3) ºС не более 36 суток.

    Инструкция по применению грунтовки носит рекомендательный характер и не заменяет профессиональной подготовки исполнителя работ. При несоблюдении инструкций и рекомендаций по хранению и применению, производитель не несет ответственности за качество проведенных работ.

  • Сертификаты

    Свидетельство о государственной регистрации

    Отказное письмо «Об обязательном подтверждении соответствия продукции»

    Отказное письмо о соответствии требованиям пожарной безопасности

    Техническое описание

  • Грунтовка Концентрированная 1/10 CONCENTRATED ASTAR 2,5л

    1/7 CONCENTRATED ASTAR грунтовка глубокого проникновения

    Плотная концентрированная грунтовка на водной основе с высокой проникающей способностью и адгезией.
    ХАРАКТЕРИСТИКИ
    Концентрированная грунтовка Betek 1/7-1/10 Concentrated Astar, создавая между краской и
    поверхностью связующий мостик, обеспечивает более прочное сцепление краски к поверхности.
    Уменьшает пористость поверхности, на которую наносится, предупреждает преждевременное
    высыхание краски, и предотвращает колебания цвета, которые могут возникнуть в отделочной краске на

    поверхностях, обладающих различной степенью поглощения. Обеспечивает экономию, уменьшая
    расход краски.
    ПОВЕРХНОСТИ, НА КОТОРЫЕ ПРИМЕНЯЕТСЯ
    Применяется на гипс, известь, на низкокачественные впитывающие пластиковые окрашенные поверхности, утерявшие свои свойства, газобетон и другие сильно впитывающие поверхности и/или на поверхности, обладающие свойством обсыпания.
    ПРИМЕНЕНИЕ
    Поверхности, на которые будет наноситься грунтовка, должны быть сухими, чистыми и прочными. После 
    выполнения шлифования гипсовых и подобных поверхностей, необходимо очистить поверхности от пыли при помощи влажной салфетки/влажной щетки для мытья автомобилей, и затем можно переходить к нанесению грунта. Разбавив Концентрированную Грунтовку Betek 1/7-1/10 Concentrated Astar в необходимом соотношении, нанесение выполняется при помощи щетки или малярного валика, не выполняя прочесывания/полировки поверхностей. Во время нанесения грунтовки температура поверхности должна быть в пределах +5°C — +30°C. В течение периодов нанесения грунтовки и ее высыхания необходимо защищать поверхность от замерзания.
    Не ранее, чем через 4 часа после нанесения Концентрированной Грунтовки Betek 1/7-1/10 Concentrated Astar, можно перейти к нанесению краски. Ни в коем случае не рекомендуется наносить грунтовку на краски или грунтовку на основе растворителя или на пасту с глитолином, особенно использовать с целью изоляции, выполнив прочесывание поверхности или разбавив с меньшим количеством воды.
    ВНИМАНИЕ
    Концентрированная Грунтовка Betek 1/7-1/10 Concentrated Astar не должна образовывать стеклообразный слой на поверхности. стеклообразный слой должен быть удален от поверхности путем шлифования или механическим путем, придав матовый вид поверхности. В противном случае, могут возникнуть такие проблемы, как отслаивание, растрескивание, набухание, следы валика и проблемы покрытия поверхности. Ни в коем случае нельзя наносить грунтовку методом Airless (распыления), кроме того, нельзя наносить, не разбавив грунтовку водой. 
    РАЗБАВЛЕНИЕ
    Для силиконовых красок на 1 объем грунтовки добавляется 7 объемов воды, для пластиковых красок 1
    объем грунтовки разбавляется 10 объемами воды.
    ВРЕМЯ ВЫСЫХАНИЯ (При 20°C, 65% HR)
    Высыхание до прикасания: 1 час
    Нанесение краски: 4 часа (при более высокой относительной влажности и более низкой температуре
    время высыхания может продлиться).
    РАСХОД
    В зависимости от вида, впитывающей способности и структуры поверхности, на которую будет наноситься грунтовка, 1 литром грунтовки в один слой можно покрыть поверхность площадью 40-65 м2
    ХРАНЕНИЕ
    Срок хранения в закрытой упаковке, в прохладном и сухом месте, защищенном от мороза и попадания
    прямых солнечных лучей, составляет 3 года. Сразу же после использования герметично закройте
    упаковку крышкой, не позволяя попаданию воздуха.

    Грунтовка Wakol

    Немецкая компания Wakol предлагает качественную грунтовку для укрепления цементной стяжки, грунтовку для невпитывающих оснований, быстросохнущую грунтовку Вакол, для пробкового и пакетного клея, под наливные полы, ремонтную смолу для устранения пустот (щелей) в паркете.

    Wakol — это полюбившееся всем немецкое качество, легкость и простота использования и высокие свойства паркетной химии.

    У продукции Wakol не самая низкая цена, но нужно понимать, что цена обусловлена высоким качеством химии для паркета и напольных покрытий, и намного дешевле и выгоднее сделать качественную укладку паркета и  напольных покрытий, чем переделывать пол заново или мучаться с дешевым грунтом и клеем при выполнении паркетных работ.

    Проведем эксперимент
    Цель эксперимента выбрать оптимальную грунтовку под бетонное основание и проверить качество основания

    В одном помещении у нас основание — наливной пол, в другом бетонная стяжка

    Эксперимент №1
    Наливной пол

    Проверка на сдвиг с помощью приклеивания паркета паркетным клеем Wakol PU 280 на основание из наливного пола Vetonit 3000

    с нанесением полиуретановой дисперсией или полиуретанового грунта

    1) Основание обработано универсальной полиуретановой дисперсией Wakol D 3055 для универсальных и силановых клеев

    2) Основание обработано полиуретановым грунтом Wakol PU 280

    Спустя заданное производителем время для высыхания паркетного клея, примерно через 24 часа, мы проверим его прочность

    Проверим нагрузку отрыва паркета специальным измерительным инструментом для проверки прочности на сдвиг Wakol

    Итог эксперимента.
    На наливном поле обе грунтовки Wakol — Wakol D 3055 и Wakol PU 280 показали себя с лучшей стороны . Обе грунтовки хорошо держат приклеенный шаблон.

    Испытание пройдено, пол готов к укладке фанеры.

    Эксперимент №2
    Цементно-бетонная стяжка

    Проверка качества бетонной стяжки с помощью грунтовки стяжки праймером на водной основе Wakol D 3055

    Шаблон приклеивается паркетным клеем Wakol PU 220

    Итог эксперимента.
    Очень слабая стяжка основания. Грунтовка помогает сохранить сцепление шаблона с полом , но этого недостаточно для приклеивания напольных покрытий.

    Как рассчитать концентрацию ДНК-праймера

    Расчеты могут стать проклятием лабораторной работы. К счастью, существует множество простых методов, которые помогут вам выполнить необходимые математические расчеты в лаборатории. Здесь мы расскажем вам о различных способах расчета концентрации праймера в зависимости от исходного материала.

    Для всех расчетов предположим, что у нас есть 22 нмоль ДНК-праймера, содержащего 16 оснований.

    Из лиофилизированного порошка

    Праймеры, которые вы покупаете у компаний, часто поставляются в виде лиофилизированных порошков, и компания сообщает вам, сколько нмоль праймера они предоставили.Если вы уверены, что восстановили весь порошок и ранее у вас не было проблем с количеством отправленного праймера, то быстрое ресуспендирование и расчет можно выполнить без измерения OD праймера. Однако, если ваше последующее применение с праймером очень чувствительно к концентрации праймера или если вы не уверены в качестве праймера, вам следует измерить оптическую плотность праймера после ресуспендирования и использовать для расчета второй метод, описанный ниже.

    Метод 1)   Ресуспендируйте праймер в 100 мкл воды или буфера и используйте следующий расчет:

    (XX нмоль/100 мкл) x (1000 пмоль/нмоль)= пмоль/мкл = мкМ

    Пример: (22 нмоль/100 мкл) x (1000 пмоль/нмоль) = 220 пмоль/мкл = 220 мкМ

    Метод 2)    В качестве альтернативы можно быстро ресуспендировать праймер до концентрации 100 мкМ путем ресуспендирования порошка в объеме в микролитрах, который в 10 раз превышает количество нмоль.

    Пример: Ресуспендируйте 22 нмоль праймера в 220 мкл = 100 мкМ

    Из жидкости

    Иногда мы не так внимательны и организованы, как должны быть, и находим в морозилке тюбики с капсюлями без указания концентрации. Иногда вы даже можете обнаружить, что не восстанавливаете полное количество лиофилизированного праймера, отправленного компанией. В этих случаях вы можете легко рассчитать концентрацию праймера по показаниям OD 260 . Предположим, что мы разбавили праймер сверху 1:200, и показание OD260 было равно 0.132.

    Концентрацию можно рассчитать по следующим формулам:

    (OD 260 ) x (0,02*) x (коэффициент разбавления) = мкг/мкл       * Коэффициент пересчета для одноцепочечной ДНК

    (мкг/мкл/330 дальтон/нт**) x (10 6 /# нт) = мкМ    **Средняя молекулярная масса на нуклеотид

    Пример: (0,132)(0,02)(200)=0,528 мкг/мкл

    (0,528/330) x (10 6 /16)= 100 мкМ

    Вопросы? Дайте нам знать ниже в разделе комментариев!

    Первоначально опубликовано в 2013 году. Обновлено и переиздано в 2017 г.

    Высокая концентрация праймеров улучшает ПЦР-амплификацию из случайных пулов | Исследование нуклеиновых кислот

    Успех ПЦР частично основан на характеристиках экспоненциальной амплификации. Тем не менее, на практике достижимые урожаи ограничены. На рис. 1А и В показана количественная оценка типичной реакции с различными, но определенными количествами исходного шаблона.Каждые пять циклов отбирали аликвоту реакционной смеси, после чего определяли количество накопленного продукта. Хотя первоначально скорости амплификации всех реакций достигали теоретического предела 32-кратной амплификации в течение пяти циклов (обозначено пунктирной линией), на более поздних циклах наблюдалось резкое снижение скоростей амплификации. Интересно, что это снижение, имевшее место во всех реакциях, не зависело от общего числа циклов в каждой реакции, а скорее было связано с количеством накопленного продукта.Чтобы узнать больше об основе этого явления, я исследовал влияние концентрации праймеров на ПЦР. Для стандартных применений рекомендуется концентрация праймера от 0,1 до 1 мкМ (1), и редко праймер полностью расходуется во время реакции. Тем не менее праймерам приходится конкурировать с накапливающимся продуктом в поиске своей целевой последовательности, что может стать лимитирующим фактором для реакции на поздних циклах. Чтобы проверить, влияет ли соотношение между концентрацией праймера и продукта на выход продукта, я провел реакции с увеличивающимся количеством праймеров, но в других идентичных условиях.Для всех испытанных реакций наблюдалось увеличение выхода продукта на поздних, но не на ранних этапах амплификации. Тем не менее, уровень улучшения сильно различался для протестированных реакций: увеличение от 2 до почти 20 раз наблюдалось при изменении концентрации праймера от 1 до 20 мкМ (данные не показаны и рис. 1C), что указывает на то, что предельные компоненты в значительной степени различаются для индивидуальных реакций. Хотя высокая концентрация праймеров может увеличить неспецифический прайминг при применении к сложному исходному материалу, такому как геномная ДНК (2), эксперименты ясно показывают, что ограничение праймеров может вносить решающий вклад в ослабление скорости амплификации, наблюдаемое для поздних циклов ПЦР.

    Рисунок 1

    ( A ) Количественный анализ типичной ПЦР. От 0,01 до 100 нг линеаризованной плазмиды длиной 5,4 т.п.н., содержащей указанное количество матрицы 255 п.н., полученной из гена Herpes simplex VP16 , наносили на реакционные смеси объемом 50 мкл. Циклы ПЦР проводили в течение 30 с при 94°С, 60 с при 60°С и 60 с при 72°С с ​​праймерами: GCGGAATTCGCCCCCCCGACCGATGTCAGC и CGCGAATTCTACCACCCGTACTCGTCAAT, оба в концентрации 1 мкМ в стандартном ПЦР-буфере (50 мМ KCl, 10 мМ трис, рН 8.3, 0,01% желатина и 1,5 мМ MgCl 2 ), содержащего 4 ед. ДНК-полимеразы Taq (USB). После каждых пяти циклов аликвоты по 8 мкл отбирали из реакционных смесей, затем разделяли на агарозном геле и визуализировали окрашиванием бромистым этидием. Показаны только соответствующие части гелей для указанного количества циклов. ( B ) Количественное определение этого анализа в соответствии со стандартами, присутствующими на том же геле. ( C ) ПЦР из случайных пулов. Один нг 86-мерного олигонуклеотида, содержащего 35 вырожденных положений в середине, амплифицировали со следующими праймерами, соответствующими фланкирующим последовательностям: GCGGGATCCACTC CAGGCCGGATGCT и GCGGGATCCGCCTTACACCCTGGTG.Стадии инкубации для каждого цикла составляли: 30 с при 94°С, 30 с при 60°С и 30 с при 72°С. После номера цикла, указанного вверху, аликвоты удаляли и продолжали, как описано выше. Реакции проводили в тех же условиях, что и описанные выше, за исключением того, что использовали три разные концентрации праймеров (1, 5 и 25 мкМ), как указано внизу. Миграцию гомодуплексов (ho) и гетеродуплексов (he) проверяли путем экспериментов по смешиванию гомогенных фрагментов (данные не показаны).Аналогичные результаты были получены при температурах отжига 55 и 65°С.

    Рисунок 1

    ( A ) Количественный анализ типичной ПЦР. От 0,01 до 100 нг линеаризованной плазмиды длиной 5,4 т.п.н., содержащей указанное количество матрицы 255 п. н., полученной из гена Herpes simplex VP16 , наносили на реакционные смеси объемом 50 мкл. Циклы ПЦР проводили в течение 30 с при 94°С, 60 с при 60°С и 60 с при 72°С с ​​праймерами: GCGGAATTCGCCCCCCCGACCGATGTCAGC и CGCGAATTCTACCACCCGTACTCGTCAAT, оба в концентрации 1 мкМ в стандартном ПЦР-буфере (50 мМ KCl, 10 мМ трис, рН 8.3, 0,01% желатина и 1,5 мМ MgCl 2 ), содержащего 4 ед. ДНК-полимеразы Taq (USB). После каждых пяти циклов аликвоты по 8 мкл отбирали из реакционных смесей, затем разделяли на агарозном геле и визуализировали окрашиванием бромистым этидием. Показаны только соответствующие части гелей для указанного количества циклов. ( B ) Количественное определение этого анализа в соответствии со стандартами, присутствующими на том же геле. ( C ) ПЦР из случайных пулов. Один нг 86-мерного олигонуклеотида, содержащего 35 вырожденных положений в середине, амплифицировали со следующими праймерами, соответствующими фланкирующим последовательностям: GCGGGATCCACTC CAGGCCGGATGCT и GCGGGATCCGCCTTACACCCTGGTG. Стадии инкубации для каждого цикла составляли: 30 с при 94°С, 30 с при 60°С и 30 с при 72°С. После номера цикла, указанного вверху, аликвоты удаляли и продолжали, как описано выше. Реакции проводили в тех же условиях, что и описанные выше, за исключением того, что использовали три разные концентрации праймеров (1, 5 и 25 мкМ), как указано внизу. Миграцию гомодуплексов (ho) и гетеродуплексов (he) проверяли путем экспериментов по смешиванию гомогенных фрагментов (данные не показаны).Аналогичные результаты были получены при температурах отжига 55 и 65°С.

    Процедуры отбора из случайных библиотек стали мощным инструментом для определения высокоаффинных взаимодействий с ДНК и РНК (3). В этих процедурах небольшое количество отобранного материала амплифицируется с помощью ПЦР для следующего раунда селекции, а последовательное повторение приводит к ступенчатому обогащению специфически взаимодействующих последовательностей. Я использовал олигонуклеотид, состоящий из 86 нуклеотидов с 35 вырожденными положениями, для селекции сайтов связывания in vitro (4). Количественный анализ ПЦР этого олигонуклеотида привел к кривой амплификации, аналогичной рис. 1В. Для стандартных концентраций праймеров (1 мкМ) скорость амплификации падала уже при 100 нг продукта/100 мкл, тогда как теоретический предел для этой концентрации праймера составлял бы 5,6 мкг продукта/100 мкл. Хуже того, уже после 15 циклов интенсивного повторного отжига большинство фрагментов превратилось в гетеродуплексы, что привело к сдвигу подвижности в агарозном геле (рис. 1С). Такое образование гетеродуплекса резко уменьшает пул выбираемых последовательностей.При добавлении в реакцию большего количества праймеров общий выход продукта резко возрастает, что указывает на то, что концентрация праймеров является основным ограничивающим фактором для этой реакции. Более того, избыток праймеров в реакции препятствовал образованию гетеродуплексов даже на поздних циклах реакции, что свидетельствует о взаимозависимости между повторным отжигом продукта и снижением скорости амплификации. Следовательно, для данного применения ПЦР увеличение концентрации праймеров существенно улучшает выход, а также качество продукта.

    Благодарности

    Я благодарен Г. Шаффнеру за синтез олигонуклеотидов, Х. Ткадлетцу за графическую работу и М. Бусслингеру за критическое прочтение этой рукописи.

    Ссылки

    1,  ,  ,  . , 

    ПЦР: клиническая диагностика и исследования

    1992

    Berlin

    Springer-Verlag

    2,  . ,  ,  ,  . , 

    Протоколы ПЦР

    1990

    Нью-Йорк

    Academic Press

    (стр.

    3

    12

    )3,  . , 

    Курс. мнение Биотех.

    ,

    1995

    , том.

    6

     (стр. 

    65

    72

    )4,  . ,

    мол. Клетка. биол.

    ,

    1995

    , том.

    15

     (стр. 

    2858

    2871

    )

    © 1996 Издательство Оксфордского университета

    Индустриализация сельского хозяйства — производство продуктов питания — введение в пищевую систему

    Справочная информация


    Мясокомбинат чикагского Union Stockyards был обширным предприятием, которое занималось забоем, переработкой, упаковкой и распределением крупного рогатого скота и свиней. Работая к 1865 году, это было одно из первых предприятий США, которые продемонстрировали промышленную модель, создав прецедент, которому последуют другие отрасли. Генри Форд даже считал, что линии по «разборке» животных на Union Stockyards вдохновили его на идею создания его заводов по производству автомобилей. 3

    Фото предоставлено Джоном Вашоном, 1941 год. Общественное достояние.

    Щелкни по изображениям, чтобы увидеть подписи

    В начале 1900-х годов более половины американцев были либо фермерами, либо жили в сельской местности. 1 Большинство ферм в США были диверсифицированы, то есть они выращивали различные культуры и виды животных вместе на одной ферме взаимодополняющими способами. 2 Фермеры были квалифицированы в широком диапазоне ремесел и имели право самостоятельно управлять своими культурами и животными. Животные обычно выращивались с доступом на улицу. Большую часть работы на ферме выполняли люди или животные.

    Хотя подобные условия все еще существуют, индустриализация сельского хозяйства радикально изменила способ производства подавляющего большинства продуктов питания в США.С. и многих других частях света. За короткий период 20 -го века сельское хозяйство претерпело большие изменения, чем с тех пор, как оно было впервые принято около 13 000 лет назад. Современное сельское хозяйство США было описано как «самое эффективное в мире, по крайней мере, с точки зрения затрат на производство в долларах и центах». 1 Однако затраты на здравоохранение и экологию, связанные с индустриализацией, не отражаются на ценах на продукты питания.

    Специализация


    Урожай пшеницы в Айдахо.

    Специализация направлена ​​на повышение эффективности за счет сужения круга задач и ролей, задействованных в производстве. Этот подход применялся почти ко всем аспектам производства продуктов питания. Диверсифицированные фермы уступили место генетически однородным монокультурам — полям, засеянным только одним видом сельскохозяйственных культур за один раз на очень большой площади.

    Фото предоставлено USDA. Всеобщее достояние.


    Работники сигарной фабрики. Тампа, Флорида; около 1920 г.

    В начале 1900-х годов более половины американцев были фермерами или жили в сельских общинах.Говорят, что индустриализация сельского хозяйства достигла двух целей: «освободить» американцев от сельского хозяйства, чтобы они могли присоединиться к рабочей силе в офисах и на фабриках, и удешевить продукты питания и сельское хозяйство, чтобы американцы могли позволить себе покупать продукты, предлагаемые новыми отраслями. . 4

    Фото в общественном достоянии.

    Щелкайте изображения для подписей

    Специализация направлена ​​на повышение эффективности за счет сужения круга задач и ролей, задействованных в производстве.Например, диверсифицированному фермеру может потребоваться выращивать и ухаживать за многими различными овощными культурами, компостированием, стадом кур-несушек, свиноматкой и ее поросятами. Специализированные фермеры, напротив, могут сосредоточить все свои знания, навыки и оборудование на одном или двух предприятиях, таких как выращивание кукурузы и сои или откорм мясного скота. В ходе индустриализации специализация применялась почти ко всем аспектам производства продуктов питания.

    Диверсифицированные фермы уступили место генетически однородным монокультурам — полям, засеянным только одним видом сельскохозяйственных культур, например кукурузой, пшеницей или соей, на очень большой площади.Производство мяса, молока и яиц стало в значительной степени отделено от растениеводства и включало помещения, в которых содержались животные одной породы в течение определенного периода их жизни для единственной цели (например, для разведения, кормления или убоя). Фермеры, когда-то искусные в самых разных профессиях, стали выполнять более специализированные роли.

    Специализация также применялась к генетике животных, поскольку в ходе селекции производились животные, предназначенные для достижения единственного результата — например, крупного грудного мяса или увеличения производства молока.По сравнению с цыплятами 1930-х годов, сегодняшние цыплята, выращиваемые на мясо («бройлеры»), вырастают почти в два раза быстрее, менее чем в два раза быстрее, потребляя в два раза меньше корма. 5 Генетическая селекция по этим преувеличенным признакам часто происходит за счет здоровья животных, включая повышенный риск сердечной недостаточности у бройлеров и инфекции вымени у молочных коров, выращиваемых для получения более высокой молочной продуктивности. 6

    Механизация


    Зерноуборочный комбайн выполняет сразу два процесса: срезка зерна (жатка) и отделение его от несъедобной части (обмолот).

    Механизация сельского хозяйства значительно снизила потребность в человеческом и животном труде. С 1950 по 2000 год производство на фермах США увеличилось более чем в два раза при затратах на рабочую силу менее трети. 9

    Фото предоставлено Дэном Дэвидсоном, 2010 г. Creative Commons CC BY 2.0.


    Обмолот риса. Харнатар, Индия; около 1906 г.

    Механизация значительно повысила эффективность. Вручную человек может обмолотить примерно от 15 до 40 кг зерна в час, обычно ударяя собранный урожай о твердую поверхность, чтобы стряхнуть зерно с несъедобной мякины, которая его окружает. За то же время механизированная молотилка может переработать от 450 до 600 кг риса, сорго или бобов или от 1500 до 2000 кг кукурузы. 8

    Фото: общественное достояние.

    Щелкайте изображения для подписей

    Подобно работе на конвейере, специализированный труд часто включает повторяющиеся задачи, которые могут выполняться машинами. Это означало, что рутинные работы, такие как посев семян, сбор урожая, доение коров, кормление и забой животных, могли быть механизированы, что уменьшало (а в некоторых случаях устраняло) потребность в человеческом и животном труде.Между 1900 и 2000 годами доля рабочей силы США, занятой в сельском хозяйстве, снизилась с 41 до 2 процентов. 7

    В некоторых случаях механизация значительно повысила эффективность. Зерновые и бобовые культуры, такие как кукуруза, пшеница, рис и соя, должны быть срезаны с полей (собраны) и удалены с несъедобных частей растения (обмолочены). Выполнение этого вручную требует огромного количества времени и усилий. Вручную человек может обмолотить примерно от 15 до 40 кг зерна в час, обычно ударяя собранный урожай о твердую поверхность, чтобы стряхнуть зерно с несъедобной мякины, которая его окружает.За то же время механизированная молотилка может переработать от 450 до 600 кг риса, сорго или бобов или от 1500 до 2000 кг кукурузы. 8

    Химические и фармацевтические ресурсы


    Применение удобрений для посевов в США, 1964–1992 гг.

    Синтетические азотные удобрения, внедренные в начале 1900-х годов, приписывают кормление львиной доли населения мира, которое выросло с 1,6 до 6 миллиардов за 20 век. Всего за 12 лет, с 1964 по 1976 год, применение синтетических и минеральных удобрений на U.Урожай С. почти удвоился. 10


    Применение пестицидов на основных сельскохозяйственных культурах в США, 1964–1992 гг.

    В период с 1964 по 1976 год общее количество применений пестицидов на основных сельскохозяйственных культурах в США увеличилось на 143 процента. Большая часть этого приходится на использование гербицидов. За годы, показанные на этом графике, на урожай кукурузы в США приходилось наибольшая доля использования пестицидов и удобрений. 10

    Щелкни по изображениям, чтобы увидеть подписи

    В начале 1900-х годов появились синтетические удобрения и химические пестициды, инновации, которые стали визитной карточкой промышленного растениеводства.Всего за 12 лет, с 1964 по 1976 год, применение синтетических и минеральных удобрений для сельскохозяйственных культур в США почти удвоилось, а использование пестицидов для основных сельскохозяйственных культур в США увеличилось на 143 процента. 10 Переход к специализированным монокультурам увеличил зависимость фермеров от этих химикатов, отчасти потому, что разнообразие культур может помочь подавить сорняки и других вредителей. 11,12

    Использование химических и фармацевтических препаратов также стало обычным явлением в новых индустриальных моделях производства мяса, молока и яиц. Антибиотики, например, стали добавлять в корма для свиней, домашней птицы и крупного рогатого скота после того, как серия экспериментов в 1940-х и 1950-х годах показала, что кормление животных лекарствами заставляло их быстрее набирать вес и потреблять меньше корма. 13 К 2009 году 80 процентов антибиотиков, продаваемых в США, использовались не для лечения людей, а для животноводства. 14

    Как и в случае с другими тенденциями индустриализации, использование химических и фармацевтических ресурсов в сельском хозяйстве обеспечило повышение производительности, но не обошлось без последствий для здоровья и окружающей среды.

    Консолидация


    Консолидация ферм США, 1950–1997 гг.

    Консолидация в сельском хозяйстве — это переход к меньшему количеству ферм и увеличению их размера. Общее количество ферм в США сократилось с 5,39 миллиона до 1,91 миллиона в период с 1950 по 1997 год. За тот же период средний размер ферм в США увеличился более чем вдвое (с 215 до 487 акров). 17


    Консолидация свиноферм США, 1955–2015 гг.

    Номер У.Количество свиноферм S. сократилось с 1,85 миллиона до 63 000 в период с 1959 по 2012 год. За тот же период среднее количество свиней на ферму увеличилось с 37 до 1044. Шестьдесят процентов свиней в США выращиваются в помещениях, в которых одновременно содержится более 5000 животных. 17

    Изображение предоставлено: Брент Ким, Центр пригодного для жизни будущего Джона Хопкинса.

    Щелкни по изображениям, чтобы увидеть подписи

    Консолидация в сельском хозяйстве — это переход к меньшему количеству и увеличению размеров ферм, обычно в результате того, что крупные фермы становятся все более крупными, а мелкие фермы разоряются.В конце 1950-х годов министр сельского хозяйства США Эзра Тафт Бенсон проиллюстрировал давление правительства с целью консолидации, когда призвал фермеров «разбогатеть или уйти». 15

    В период с 1950 по 1997 год размер средней фермы в США увеличился более чем вдвое, и осталось менее половины ферм. 16 В производстве мяса, молочных продуктов и яиц поголовье животных на каждой ферме резко возросло, а количество мелких ферм сократилось. Многие другие отрасли продовольственной системы, в том числе забой и переработка животных, также подверглись серьезной консолидации.

    Что привело к консолидации? Новые технологии, в том числе химикаты и более крупные тракторы, позволили фермерам обрабатывать большие площади земли с меньшими затратами труда. 2 Государственная политика поощряла фермеров расширять свою деятельность. Фермеров также мотивировала экономия за счет масштаба — экономическое преимущество производства большего количества продуктов. Например, птицевод может получать большую прибыль от каждой птицы, размещая большее количество птиц (до определенного момента).

    В основном в результате консолидации большая часть производства продуктов питания в США.С. в настоящее время занимает место на массовых операциях. Половина всех пахотных земель США приходится на фермы площадью не менее 1000 акров (более 1,5 квадратных миль). 2 Подавляющее большинство продуктов из мяса птицы и свинины в США поступает с предприятий, каждое из которых производит более 200 000 цыплят или 5 000 свиней в год, в то время как большинство кур-несушек содержатся в помещениях, в которых одновременно содержится более 100 000 птиц. 17

    Концентрация рынка


    Доля продаж четырех крупнейших компаний в соответствующих отраслях. 20,25

    Доходы от пищевой и сельскохозяйственной промышленности все больше концентрируются среди небольшого числа влиятельных компаний. В индустрии забоя и переработки говядины в США четыре крупнейшие компании получают 82 процента продаж.

    Изображение предоставлено: Майкл Милли и Брент Ким. Johns Hopkins Center for a Liveable Future, 2013.

    Щелкните изображения, чтобы получить подписи

    Решения о том, кто производит наши продукты питания, какие продукты производятся, как они производятся и кто может есть эти продукты, неуклонно менялись от … домохозяйств и правительств в … залы заседаний совета директоров корпораций.

    – Мэри Хендриксон и Харви С. Джеймс мл. 18

    Доля рынка – это доля продаж в отрасли, полученная одной компанией. Например, на рынке соленых закусок в США 64% продаж приходится на PepsiCo. 19

    Когда небольшое количество компаний имеет большую долю рынка в отрасли, говорят, что рынок для этой отрасли сконцентрирован. Рынки становятся более концентрированными, когда компании поглощают своих конкурентов или сливаются с ними.

    В ходе индустриализации рынки продуктов питания и сельскохозяйственной продукции становились все более концентрированными. Например, в индустрии забоя и переработки говядины в США четыре крупнейшие компании получают 82 процента продаж. 20 В индустрии супермаркетов четыре компании зарабатывают не менее 42 процентов продаж. 21

    Вертикальная интеграция — это тип концентрации рынка, когда компании получают контроль над несколькими отраслями, производящими одни и те же продукты. Компания Smithfield Foods, например, занимается разведением, производством, убоем, переработкой и продажей свиней и продуктов из свинины. 22 Небольшое количество могущественных корпораций имеют аналогичный контроль над птицеводческой промышленностью.

    Что означает концентрация рынка для фермеров и потребителей? В некоторых случаях концентрация рынка может снизить цены для потребителей и увеличить продажи. 23 С другой стороны, при меньшем количестве конкурентов на концентрированном рынке доминирующие компании могут получить больше возможностей влиять на цены в свою пользу. 23 Они также могут диктовать, как производить продукты питания, оставляя фермерам мало выбора в том, как выращивать урожай или разводить животных. 18 Многие высококонцентрированные корпорации также имеют сильное присутствие в государственных учреждениях, где они могут влиять на политику в свою пользу. 24

    Ресурсы

    Следующий список предлагаемых ресурсов предназначен в качестве отправной точки для дальнейшего изучения и никоим образом не является исчерпывающим. Некоторые материалы могут не отражать точку зрения Центра пригодного для жизни будущего Джона Хопкинса.

    Для учителей

    Отчеты

    Статьи в академических журналах

    Книги

    Ссылки

    Поддержание рентабельности сельского хозяйства. В: Роль экономиста в парадигме устойчивого развития сельского хозяйства . Сан-Антонио, Техас: Университет Миссури; 1996.
    2. Макдональд Дж., Корб П., Хоппе Р. Размер фермы и организация растениеводства в США . 2013.
    3. Рифкин Дж. Помимо говядины: взлет и падение культуры крупного рогатого скота . Нью-Йорк, Нью-Йорк: Плюм; 1993.
    4. Икерд Ю.Э. Поддержание рентабельности сельского хозяйства. В: Роль экономиста в парадигме устойчивого развития сельского хозяйства . Сан-Антонио, Техас: Университет Миссури; 1996.
    5. Стриффлер С. Цыпленок: опасная трансформация любимой еды Америки . Нью-Хейвен: издательство Йельского университета; 2005.
    6. Рау В.М., Канис Э., Нордхуйзен-Стассен Э., Громмерс Ф. Нежелательные побочные эффекты селекции на высокую продуктивность сельскохозяйственных животных: обзор. Живая продукция Sci . 1998;56(1):15-33.
    7. Дмитрий С., Эффланд А., Конклин Н. Трансформация сельского хозяйства и сельскохозяйственной политики США в ХХ веке. USDA ERS . 2006.
    8. М. де Люсия, Ассеннато Д. Сельскохозяйственная инженерия в развитии: послеуборочные операции и управление продовольственным зерном . Продовольственная и сельскохозяйственная организация Объединенных Наций; 1994.
    9. Служба экономических исследований Министерства сельского хозяйства США. Производительность сельского хозяйства в США. 2014.
    10. Лин Б.-Х., Пэджитт М., Булл Л., Делво Х., Шэнк Д., Тейлор Х. Использование пестицидов и удобрений и тенденции в сельском хозяйстве США . 1995.
    11. Либман М., Дэвис А.С. Интеграция управления почвой, культурами и сорняками в сельскохозяйственные системы с низкими внешними затратами. Сорняк Res . 2000;40:27-47.
    12. Киршенманн ФЛ. Потенциал нового поколения биоразнообразия в агроэкосистемах будущего. Агрон Дж . 2007;99(2):373-376.
    13. Густафсон Р.Х., Боуэн Р.Е. Применение антибиотиков в животноводстве. J Appl Microbiol . 1997;83(5):531-41.
    14. Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США. Письмо достопочтенной Луизе М. Слотер: продажа антибактериальных препаратов в килограммах . Вашингтон.; 2010.
    15. Зимдал Р.Р. Этический горизонт сельского хозяйства . 2-е изд. Уолтем, Массачусетс: Эльзевир; 2012.
    16. Хоппе Р.А., Банкир Д.Э. Структура и финансы У.S. Фермы: Отчет о семейных фермах за 2005 г. . Vol Economic I. Служба экономических исследований Министерства сельского хозяйства США; 2006.
    17. Министерство сельского хозяйства США. Сельскохозяйственная перепись США 2012 года. 2014.
    18. Хендриксон М.К., Джеймс Х.С. Этика ограниченного выбора: как индустриализация сельского хозяйства влияет на сельское хозяйство и поведение фермеров. J Сельскохозяйственная экологическая этика . 2005;18(3):269-291.
    19. Купер Т. Эта компания стремится доминировать в сфере закусок. Пестрый дурак . 2013.
    20. Джеймс Х.С., Хендриксон М.К., Ховард П.Х. Сети, власть и зависимость в агропродовольственной промышленности.В: Джеймс Х.С., изд. Этика и экономика агропродовольственного конкурса . Дордрехт: Springer Science-Business Media Press; 2013: 99-126.
    21. Хендриксон М., Хеффернан В. Концентрация сельскохозяйственных рынков . 2007.
    22. Мартинес С.В. Вертикальная координация в свиноводстве и производстве бройлеров: последствия для продуктов из свинины и курицы . 1999.
    23. Шилдс Д.А. Консолидация и концентрация в молочной промышленности США . 2010.
    24. Икерд Ю.Э. Кризис и возможности: устойчивость американского сельского хозяйства . Линкольн, Небраска: University of Nebraska Press; 2008.
    25. Heffernan WD, Douglas HC. Концентрация сельскохозяйственных рынков . 1990.

    Начальный балет: концентрированный учебник для начинающих балетных студентов всех возрастов: с оригинальным вступлением Кей Эмброуз, Лоусон, Джоан. Амброуз, Кей (введение): Good+ в твердом переплете (1977), первое изд.

    Стоковое изображение

    Опубликовано Адамом и Чарльзом Блэком, Лондон, 1977 г.

    Использовал Состояние: Хорошее+ Твердый переплет


    Об этом товаре

    8 «х 8.5». Солнцезащитные очки на корешке, небольшой надрыв в верхней части корешка, чернильная подпись владельца на ffep. Включает в себя «Beginners, Please!» покойной Кей Эмброуз и «Dressing for the Ballet» покойного Питера Ревитта и Джоан Лоусон, которые переработали некоторые материалы из обеих книг.Опись продавца #19660

    Задать вопрос продавцу

    Библиографические данные

    Название: Начало балета: концентрированный праймер для …

    Издатель: Адам и Чарльз Блэк, Лондон

    Дата публикации: 1977

    Переплет: твердый переплет

    Состояние книги: Хорошее+

    Издание: Первое изд.

    Описание магазина

    В маленьком городке Бере Алстон, который находится в «область выдающейся природной красоты». Он открыт пять дней в неделю (закрыт по средам и воскресеньям) с 10:00 до 16:30. Это район добычи полезных ископаемых, и я заинтересован в покупке книг по горному делу и академических книг в больших количествах.

    Посетите витрину продавца

    Условия продажи:

    Уточняйте при заказе, если не согласовано. Для оплаты почтовых расходов добавьте 3 за книгу
    в Великобритании и 6 долларов США или эквивалентную сумму за книгу за наземную почтовую доставку
    по всему миру. Воздушная почта по себестоимости. Принимаются личные чеки в долларах.Пожалуйста,
    , сделайте чеки на имя П. Р. Черчера. Взяты карты VISA JCB MasterCard American Express и
    Switch.


    Условия доставки:

    Стоимость доставки указана для книг весом 2,2 фунта или 1 кг. Если ваш заказ книги тяжелый или негабаритный, мы можем связаться с вами, чтобы сообщить, что требуется дополнительная доставка.

    Список книг этого продавца

    Способы оплаты
    принимаются продавцом

    Проверять Денежный перевод Денежные средства PayPal Счет Банковский драфт Банковский перевод

    ARDEX P 51 — Концентрированная грунтовка и связующее вещество на водной основе

    Характеристики

    • Многоцелевой — Подходит для широкого спектра применений
    • Простота в использовании, разбавление в соответствии с применением
    • Для полов, стен и потолков, включая плотные и пористые поверхности
    • Идеально подходит для герметизации и грунтовки гипса штукатурки и стяжки на основе
    • Минимизирует образование пузырьков воздуха через выравнивающие смеси и пористые поверхности
    • Слабый запах и без растворителей многоцелевая грунтовка на водной основе без растворителей с широким спектром применения, которая после высыхания препятствует проникновению воды из наносимых впоследствии материалов.

      ПРИМЕНЕНИЕ

      Продукт предназначен для подготовки внутренних полов, стен и потолков к нанесению растворов на цементной основе (выравнивающие составы, клеи для плитки, стяжки), а также материалов на основе гипса, улучшая адгезию в качестве связующего вещества и замедляя смачивание основания нанесенными материалами.

      Эффективный герметик для пор на впитывающих основаниях, препятствующий образованию пузырьков воздуха за счет последующего нанесения сглаживающих и выравнивающих составов, тем самым продлевая срок их текучести и удобоукладываемость.

      ARDEX P 51 можно использовать для грунтовки и герметизации поверхностей материалов на основе цемента или гипса, таких как штукатурка стен, полы на основе цемента или подготовленные ангидридные и альфа-полугидратные стяжки перед нанесением продуктов на цементной основе, таких как выравнивающие составы. и плиточный клей.

      ARDEX P 51 может использоваться в качестве связующего вещества для улучшения сцепления с плотными и гладкими бетонными основаниями и плотными цементными стяжками перед использованием ремонтных растворов или плиточных клеев на цементной основе.

      Подходит для грунтования оснований из фанеры на жесткой основе и кондиционированных перед укладкой керамической плитки с помощью соответствующих плиточных клеев на цементной основе.

      ARDEX P 51 может использоваться в качестве временного защитного покрытия на цементных выравнивающих и ремонтных смесях, где по ним необходимо пройтись перед укладкой напольного покрытия, а также в качестве временной защиты от пыли на стяжках.

      ПОДГОТОВКА ПОВЕРХНОСТИ

      Основания должны быть сухими, защищенными работающим DPM, прочными и свободными от пыли, водорастворимых материалов,

      остатков клея и других препятствий для адгезии.Поверхностные загрязнения, такие как остатки полироли, воска, жира и т. д., должны быть удалены с помощью обезжиривателя ARDEX DGR перед подходящей механизированной подготовкой.

      ARDEX P 51 не рекомендуется использовать на металлическом и битумном мастике, избыточных остатках клея,

      полиуретановых и эпоксидных покрытиях ARDEX DPM. Обратитесь к техническим описаниям вододисперсионного эпоксидного грунта ARDEX P 82 и эпоксидного грунта общего назначения ARDEX R 3 E для получения рекомендаций.

      ПРИМЕНЕНИЕ

      Тщательно встряхните контейнер перед использованием и при необходимости разбавьте, поместив ARDEX P 51 в чистый контейнер и смешайте с необходимым количеством воды в соответствии с выбранным соотношением смешивания.Убедитесь, что температура окружающей среды и температура грунтуемой поверхности выше 5°C.

      Если ARDEX P 51 используется там, где впоследствии будут наноситься чувствительные к влаге материалы, основание должно быть сухим, т. е. с напольными материалами стяжка должна иметь показатель относительной влажности не более 75 %, а при непосредственном контакте с землей должна быть защищена эффективная влагозащитная мембрана. №

      Равномерно нанесите грунтовочный слой мягкой щеткой или щеткой на прочную, чистую и обеспыленную поверхность и дайте ему полностью высохнуть до образования прозрачной тонкой синей пленки перед началом любых последующих работ.

      ИСПОЛЬЗОВАНИЕ В СОЕДИНИТЕЛЬНЫХ ПОКРЫТИЯХ ДЛЯ СТЯЖЕК

      ARDEX P 51 также отлично подходит для улучшения адгезии склеенных цементных и песчаных стяжек ARDEX A 35. Наилучшие результаты достигаются при смешивании ARDEX P 51 Primer 1:1 с водой, а затем смешивании со смесью из 1 части цемента ARDEX A 35 и 1 части песка для стяжки для получения требуемой консистенции вяжущего раствора/затирки. Может также использоваться для производства связующего раствора/раствора для обычных цементных и песчаных стяжек, просто используйте обычный портландцемент вместо цемента ARDEX A 35.

      ПРИМЕЧАНИЕ: Всегда наносите свежую стяжку на связующее покрытие.

      Примечание: Вышеуказанные показатели покрытия будут варьироваться в зависимости на шероховатость поверхности и впитывающую способность подложки.

      .

      Таблица покрытия

      частей Ardex P 51 до воды

      Разведение

      Приблизительное покрытие на

      5 кг ARDEX P 51

      Неразбавленный на деревянных полах

      Нет

      25 кв. / m

      1 Часть P 51 -: ½ Часть Вода

      1: ½

      5

      1: ½

      25 кв. / М

      1 Часть P 51 -: 1 Часть Вода

      1: 1

      1: 1

      33 кв.м / М

      1 Часть P 51 -: 2 части воды

      1: 2

      60 кв.м. /м

      1 Часть P 51 — :3 Части воды

      1:3

      100 кв. / m

      1 Часть P 51 -: 5 частей воды

      1: 5

      1: 5

      160 кв.м.

      160 кв.м.

      ОСНОВА

      РАЗБАВЛЕНИЕ

      Гладкие и непористые основания, напр. восстановленные бетонные полы, плотные цементные стяжки, улучшенные стяжки из сульфата кальция, терраццо, песчаник, керамическая плитка и плиты.(В зависимости от информации от производителя гипсовой стяжки может потребоваться соответствующий слой эпоксидной грунтовки, засыпанной песком, такой как влагостойкая эпоксидная грунтовка ARDEX R 3 E). Существующие основания с остатками прилипших растворов и остатков клея для получения выравнивающих смесей и клеев на цементной основе.

      1 часть ARDEX P 51 с ½ частью воды.

      Бетонные черновые полы и потолки.

       

      1 часть ARDEX P 51 на 1 часть воды.

      Силовой поплавок Бетон.

       

      1 часть ARDEX P 51 на 2 части воды.

      Пористые или сильно впитывающие цементные стяжки для нанесения выравнивающих смесей и ремонтных растворов.

       

      1 часть ARDEX P 51 на 5 частей воды.

      Абсорбирующие и гладкие стяжки из сульфата кальция и стяжки из сульфата кальция с насосом

       

      1 часть ARDEX P 51 на 3 части воды.

      Смешивается с цементом и песком ARDEX A 35 для получения связующего раствора/покрытия при нанесении цементно-песчаной стяжки ARDEX A 35 и в качестве связующего раствора для стяжек OPC.

       

      1 часть ARDEX P 51 на 1 часть воды.

      Гладкие бетонные стены и потолки для нанесения гипсовой штукатурки

       

      1 часть ARDEX P 51 на 3 части воды.

      Для уменьшения запыления внутренних цементных стяжек или выравнивающих стяжек основания пола, которые неизбежно приходится оставлять открытыми для пешеходов и т. д., на ограниченный период.

       

      1 часть ARDEX P 51 на 3 части воды.

      *Подготовленные гипсовые оштукатуренные стены для нанесения плиточного клея на цементной основе.

       

      1 часть ARDEX P 51 на 3 части воды.

      Листы и плиты на основе древесины для получения выравнивающих составов, таких как ARDEX FA 20, или для укладки плитки плиточным клеем на цементной основе, таким как ARDEX X 7001.

      Неразбавленный


      *Сметите штукатурку жесткой щеткой, чтобы удалить любые слабо прилипшие остатки поверхности, чтобы получить прочную матовую поверхность.

      N.B. При использовании ARDEX P 51 на существующих основаниях убедитесь, что остатки выравнивающих смесей, клеев и т. д. являются водостойкими, достаточно прочными, чтобы выдерживать ожидаемые нагрузки и движение, и хорошо прилипают к основанию. Дайте грунтовочным слоям высохнуть.Всегда полностью удаляйте остатки клея, которые растворяются в воде или размягчаются водой. При наличии остатков клея на основаниях из полиуретана, эпоксидной смолы и битума необходимо использовать ARDEX P 82 в качестве адгезивного моста.

      МЕРЫ ПРЕДОСТОРОЖНОСТИ

      Водная дисперсия на основе синтетического полимера. Смыть с кожи до высыхания. Любой материал, попавший в глаза, рот или нос, следует немедленно смыть чистой водой. Избегайте приема внутрь. Нетоксичные и небольшие количества вряд ли вызовут больше, чем временный дискомфорт.При проглатывании больших количеств обратитесь за медицинской помощью.

      Для получения последней информации о здоровье и безопасности данного продукта см. действующий Паспорт здоровья и безопасности. Эту информацию можно получить на веб-сайте: www.ardex.co.uk или связавшись с офисом в Хаверхилле.

      СРОК ХРАНЕНИЯ И СРОК ГОДНОСТИ

      ARDEX P 51 следует хранить в невскрытой упаковке, отдельно от земли; в прохладных, сухих условиях и защищенных от сильного сквозняка. При правильном хранении срок годности этого продукта составляет 12 месяцев с даты, указанной на упаковке.

      КОНЦЕНТРИРОВАННАЯ ШТУКАТУРКА, МОДИФИЦИРОВАННАЯ СИЛИКОНОМ 1/7 – Ademix Boya

      ОПИСАНИЕ

      Концентрированная грунтовка на основе стирола и акрила на водной основе с высокой проникающей способностью и адгезией, разработанная для силиконовых красок.
      ХАРАКТЕРИСТИКИ

      Без запаха, образует связующий мостик между краской и поверхностью, увеличивает адгезию краски к поверхности, снижает впитывающую способность поверхности, предотвращает быстрое высыхание краски, предотвращает изменения цвета, которые могут быть видны в верхней части. окраска поверхностей с различной впитывающей способностью.Значительно снижает расход краски. Высокая проникающая способность, экологичность. НАНЕСЕНИЕ ПОВЕРХНОСТИ: Известковые, побеленные, низкокачественные впитывающие пластиковые окрашенные поверхности, которые потеряли свое качество, а также сильно впитывающие и/или сильно пылеобразующие поверхности, такие как газобетон.
      ПРИМЕНЕНИЕ

      Убедитесь, что поверхность для нанесения сухая, чистая и самонесущая. Наносить грунтовку на штукатурку или подобные поверхности только после того, как они будут отшлифованы и вычищены влажной тряпкой/влажной щеткой для мойки автомобилей/метлой.Нанесите кистью или валиком после разбавления по мере необходимости (1 единица концентрированной грунтовки, модифицированной силиконом ADEMIX 1/7 + 7 единиц воды). Убедитесь, что температура окружающей среды находится в пределах от +5°C до +30°C во время установки приложения
      . Защищайте поверхность от мороза во время нанесения и высыхания грунтовки. Начинайте наносить краску минимум через 4 часа после нанесения ADEMİX, модифицированной силиконом, концентрированной грунтовки 1/7. Наносить кистью или валиком без расчесывания и полировки (однократно прокатав валик в одном направлении).Категорически не рекомендуется использовать грунтовку в целях изоляции, разбавляя ее меньшим количеством воды или расчесывая, а также использовать грунтовку на пасте с клеем или грунтовкой и краской на основе растворителя.
      ПРЕДУПРЕЖДЕНИЕ 1

      Если верхним слоем будет пластиковая краска, отдайте предпочтение прозрачной грунтовке Filli ADEMİX Transparent Plaster Clear Primer вместо концентрированной грунтовки ADEMİX, модифицированной силиконом 1/7.
      ПРЕДУПРЕЖДЕНИЕ 2

      На поверхностях, на которые будет наноситься концентрированная грунтовка, модифицированная силиконом ADEMİX 1/7, не должно быть стеклообразного слоя.Такие стекловидные наслоения следует удалить с поверхности шлифованием или механическим способом, а поверхность матировать. В противном случае могут возникнуть проблемы с отслаиванием, растрескиванием, образованием пузырей, роликовой дорожкой и покрытием. Его следует наносить таким образом, чтобы на поверхности не образовывался пленочный слой. Не рекомендуется использовать на пылеобразующих и невпитывающих поверхностях. Коэффициент разбавления 1/10-1/12 рекомендуется для небольших поверхностей и поверхностей с небольшим пылеобразованием (если
      вы видите только поверхностную пыль на руке, когда касаетесь поверхности, можно сказать, что поверхность практически не пылится) . Но если вы видите крайнюю белизну или пыль, можно сказать, что поверхность пылится). После нанесения все использованные инструменты следует промыть водой. Никогда не следует наносить безвоздушным методом (распылением) и без разбавления
      РАЗБАВЛЕНИЕ :

      Разбавьте 1 часть грунтовки 7 единицами воды
      ВРЕМЯ ВЫСЫХАНИЯ

      (при 20°C, 65% HR) Время высыхания на отлип: 1 час Нанесение краски: 4 часа (время высыхания может увеличиться при более высокой относительной влажности и более низких значениях температуры)
      РАСХОД

      15-25 мл/м2 в один слой в зависимости от типа, впитывающей способности и структуры поверхности нанесения.1 л можно загрунтовать площадь 40-65 м2. Выполните контролируемый пробный запуск, чтобы оценить точное потребление.
      ХРАНЕНИЕ

      Срок хранения 3 года в невскрытой упаковке в прохладном и сухом месте, защищенном от мороза и прямых солнечных лучей. Плотно закройте крышку сразу после нанесения.

      Оптимизация наборов праймеров и протоколов обнаружения SARS-CoV-2 коронавирусной болезни 2019 (COVID-19) с использованием ПЦР и ПЦР в реальном времени

      Руководство по разработке и оптимизации праймеров

      процесс проверки и оптимизации наборов праймеров, используемых для тестирования на вирусы.Поэтому в этом исследовании мы сначала опишем подробные рекомендации по разработке и оптимизации наборов праймеров в три важных этапа (рис. 1а). Первым шагом является выбор целевых генов ( RdRP , N , E и S ) для обнаружения в интересующем геноме (SARS-CoV-2) и разработка праймера на основе целевого последовательность каждого гена. Для оптимальной последовательности-мишени, когда в транскрипте гена присутствует вариант сплайсинга, предпочтительна целевая область в более распространенном варианте сплайсинга.Для фактического дизайна праймера использовались различные инструменты, доступные на веб-сайте Primer3 (http://primer3.wi.mit.edu). Primer3 позволяет выбрать оптимальный праймер на основе T m , длины праймера и стабильности 3′-конца, что следует учитывать при разработке каждого набора праймеров. Второй шаг — проверка in silico последовательностей праймеров и ампликонов. Идентификация вторичной структуры ампликона и возможность образования собственного или гетеродимера самой последовательностью праймера были предсказаны на другом веб-сайте, idtdna.ком (https://sg.idtdna.com/pages/tools/oligoanalyzer). На этом веб-сайте можно оценить тенденцию к само- или гетеродимеризации путем расчета значения ΔG. Наконец, на веб-сайте gemone.ucsc.edu (https://genome.ucsc.edu/cgi-bin/hgPcr) инструмент ПЦР in silico можно использовать для прогнозирования возможности неспецифических реакций в одном и том же геноме, а также геномы разных видов. Третий шаг — экспериментальное подтверждение и оптимизация набора праймеров в биологической лаборатории. Мы оптимизировали условия ПЦР, такие как температура отжига ( T a ) с помощью градиентной ПЦР, установив температуру отжига в диапазоне от 50°C до 65°C и определив температуру, при которой была достигнута максимальная амплификация.В качестве осторожной меры важно отметить, что конечная концентрация набора праймеров в смеси для ПЦР имеет решающее значение для ПЦР, специфичной для мишени. В концентрациях, превышающих оптимальную концентрацию, праймеры могут образовывать димеры и мешать целевой ПЦР. Следовательно, для каждого набора праймеров необходимо протестировать концентрации в диапазоне от 100 нМ до 500 нМ на образование димеров. При подтверждении результатов ПЦР с помощью электрофореза необходимо проверить эффективность реакции, исходя из того, подходят ли размер полосы ампликона и количество добавленной матрицы.

      Рис. 1. Рекомендации по разработке и оптимизации праймеров для ПЦР, карта генома SARS-CoV-2 и мишени наборов праймеров.

      a Трехэтапное руководство по разработке и оптимизации праймеров для ПЦР. Шаг 1: гены-мишени были выбраны из геномных баз данных, а праймеры были разработаны с использованием Primer3. Шаг 2: наборы праймеров были оптимизированы in silico, чтобы избежать вторичной структуры в праймерах или нецелевой амплификации. Шаг 3: разработанные праймеры были оптимизированы на уровне влажной лаборатории для достижения высокой специфичности и эффективности обнаружения мишеней. b Расположение генов-мишеней и выбранных наборов праймеров в геноме SARS-CoV-2. c Структура SARS-CoV-2 с указанием каждого белка и его названия.

      Чтобы продемонстрировать важность процедуры оптимизации праймеров, мы провели ПЦР (35 циклов) с использованием различных неоптимальных наборов праймеров с матричной ДНК или без нее (кДНК SARS-CoV-2) и в различных условиях (рис. 2). ). Первый пример продемонстрировал появление ложного образования праймер-димера (рис.2а). Димер праймера — это побочный продукт ПЦР, состоящий из молекул праймера, которые гибридизуются друг с другом из-за цепочки комплементарных оснований в праймерах 22 . В первом примере мы провели ПЦР с набором праймеров SARS-CoV-2_IBS_RdRP1, о котором сообщалось ранее, 9 . Полученные данные электрофореза показали появление ложных коротких димерных полос примерно на 30–50 пар оснований (пн), а также темную полосу при ожидаемом размере ампликона 118  пн в условиях матрицы (рис.2а). Фактически полосы праймер–димер обнаруживались при любых условиях, независимо от присутствия матрицы. Кроме того, интенсивность полос праймер-димер имела тенденцию к снижению с повышением температуры. Появление полос праймер-димер свидетельствует о том, что концентрация праймера и T a не оптимальна и должна быть оптимизирована путем уменьшения концентрации праймера и увеличения T a .

      Рис. 2: Примеры результатов тестирования неоптимального набора праймеров с использованием ПЦР.

      Результаты электрофореза после ПЦР (35 циклов) с различными неоптимальными наборами праймеров с матричной ДНК или без нее (кДНК SARS-CoV-2) и в различных условиях. a Пример появления коротких димеров праймеров во всех условиях, выполненный с набором праймеров SARS-CoV-2_IBS_RdRP1. b Пример появления коротких и длинных димеров праймеров под низким T a , с набором праймеров SARS-CoV-2_IBS_S1. c Пример появления длинных димеров праймеров под низким T a , с набором праймеров SARS-CoV-2_IBS_E1. d Пример низкоэффективных праймеров в ПЦР, выполненной с набором праймеров CDC_RNAse P. e Пример появления неспецифической полосы при низком уровне T a в ПЦР, выполненной с набором праймеров SARS-CoV-2_IBS_N1. Красные звездочки указывают на длинные димеры праймеров.

      Второй пример продемонстрировал появление ложного длинного димера вместе с более короткой полосой праймер-димер (рис.2б, в). В этих примерах мы провели ПЦР с ранее опубликованными наборами праймеров SARS-CoV-2_IBS_S1 (рис. 2b) и SARS-CoV-2_IBS_E1 (рис. 2c) 9 . Хотя были сильные положительные полосы ожидаемого размера в условиях, включающих ДНК-матрицу, длинные димерные полосы появлялись при низких температурах T a  = 50 °C и 55 °C, но не при высоких T a = 60 °С, в безтемплатных условиях (красные звездочки на рис. 2б, в). Эти результаты позволяют предположить, что когда набор праймеров демонстрирует потенциал образования длинного побочного продукта ПЦР, это можно предотвратить путем увеличения T a .

      В третьем примере был обнаружен малоэффективный набор праймеров. В этом примере мы провели ПЦР с ранее описанным набором праймеров CDC_RNAse P 9 (рис. 2d). Полученные данные электрофореза показали, что во всех условиях наблюдались сильные ложные длинные и короткие полосы праймеров, а также слабые или отсутствующие ожидаемые полосы (рис. 2d). Появление этих сильных полос праймеров указывало на то, что набор праймеров проявляет избыточную тенденцию к димеризации, которая сильнее, чем его тенденция к гибридизации с матрицей.Эти результаты предполагают, что этот набор праймеров следует выбросить, а новый набор праймеров следует разработать и оптимизировать.

      Последний пример продемонстрировал появление очень длинной неспецифической полосы. В этом примере мы провели ПЦР с SARS-CoV-2_IBS_N1. Полученные данные электрофореза показали отсутствие полосы праймер-димер и сильную ожидаемую полосу в условиях, содержащих матричную ДНК (рис. 2д). Однако была ложная очень длинная неспецифическая полоса около 400  п.н. при низких T a  = 50 °C и 55 °C, но не при высоких T a  = 60 °C в отсутствие ДНК-матрица (фиг.2д). Отсутствие полосы праймер-димер указывало на то, что сам набор праймеров был оптимальным набором праймеров. Однако наличие неспецифической полосы при низкой температуре Т а свидетельствует о том, что оптимальная Т а выше и близка к Т а  = 60 °С.

      Таким образом, наборы праймеров, демонстрирующие образование праймеров-димеров, можно просто оптимизировать, увеличив T a , в то время как набор праймеров, используемый на рис. 2d, нуждается в переработке.При отсутствии оптимизации ложные димеры праймеров и образующиеся побочные продукты могут привести к появлению ложноположительной кривой при высоких значениях C t , близких к 35 циклам, и низких температурах плавления, независимо от наличия или отсутствия шаблон в ПЦР в реальном времени 23 . При разработке нового набора праймеров можно следовать трехэтапным рекомендациям, которые мы предложили на рис. 1а.

      Разработка и оптимизация праймера для SARS-CoV-2

      В этом исследовании мы планировали разработать протокол обнаружения для традиционной ПЦР, а также для ПЦР в реальном времени.Кроме того, мы планировали разработать протокол обнаружения для мультиплексной ПЦР, а также для мультиплексной ПЦР в реальном времени. Мы разработали и оптимизировали наборы праймеров для каждого протокола в соответствии с рекомендациями, показанными на рис. 1а. Список недавно разработанных наборов праймеров, а также наиболее оптимизированные наборы праймеров из предыдущего исследования 9 показаны в таблице 1. Наши наборы праймеров были разработаны специально для SARS-CoV-2, поэтому они не нацелены на другие коронавирусы человека. , такие как коронавирус человека OC43 (HCoV-OC43), коронавирус человека NL63 (HCoV-NL63), коронавирус человека HKU1 (HCoV-HKU1) и коронавирус человека 229E (HCoV-229E).

      Среди наборов праймеров, которые были разработаны для обнаружения SARS-CoV-2 на основе ПЦР в реальном времени в предыдущем исследовании 9 , некоторые наборы праймеров были повторно оценены и выбраны на основе рекомендаций по дизайну и оптимизации. представлены на рис. 1а (табл. 1). Используя выбранные наборы праймеров, мы провели традиционную ПЦР, как показано на рис. 3, и ПЦР в реальном времени, как показано на рис. 4, 5. Кроме того, недавно разработанные наборы праймеров давали ампликоны размером от 100 до 400 п.н.Эти новые наборы праймеров нацелены на RdRP , E , N и S генов SARS-CoV-2 (рис. 1b, c) и были использованы для мультиплексной ПЦР на рис. 6 (таблица 1). . Для обнаружения IPC человека мы разработали новые наборы праймеров, нацеленных на гены ACTB (Actin beta), TBP (белок, связывающий TATA-Box), 18S рРНК и GAPDH генов Homo sapiens ( Таблица 1). Эти наборы праймеров IPC использовали для контроля качества образцов кДНК, предоставленных добровольцами, и проверки методом ПЦР. Новые наборы праймеров для обнаружения мультиплексной ПЦР были оптимизированы, как показано на рис. 6а, б, в соответствии с рекомендациями, показанными на рис. 1а.

      Рис. 3: Разработка традиционного протокола ПЦР для обнаружения SARS-CoV-2.

      Гель-электрофорез – результат ПЦР (35 циклов) с использованием наборов праймеров SARS-CoV-2_IBS_E2, SARS-CoV-2_IBS_RdRP2, SARS-CoV-2_IBS_S2 и SARS-CoV-2_IBS_N1. Праймеры GAPDH использовали в качестве набора праймеров IPC. Предсказанный размер ампликонов составлял приблизительно 100 п.н. Пять нанограмм кДНК SARS-Cov-2 (4.Для каждой реакции использовали кДНК HEK-293T (1,5× 10 3 копий/реакция). Состояние без матрицы не содержало кДНК.

      Рис. 4: Улучшение протокола ПЦР в реальном времени для обнаружения SARS-CoV-2.

      ПЦР в реальном времени проводили с использованием наборов праймеров для SARS-CoV-2 SARS-CoV-2_IBS_E2, SARS-CoV-2_IBS_RdRP2, SARS-CoV-2_IBS_S2 и SARS-CoV-2_IBS_N1. Набор праймеров GAPDH использовали в качестве набора праймеров IPC. Каждая строка представляет каждый набор праймеров.Слева каждый график представляет собой график амплификации, который показывает изменение значений log (ΔRn) в зависимости от номера цикла ПЦР. Ось Y представляет нормализованное репортерное значение (Rn), которое было рассчитано как сигнал флуоресценции от SYBR Green, нормализованный к сигналу флуоресценции эталонного красителя. Графики справа представляют графики кривой плавления, которые отображают данные, собранные на этапе кривой плавления. Пики на кривой плавления могут указывать температуру плавления ( T m ) мишени или идентифицировать неспецифическую ПЦР-амплификацию.На оси Y репортерное производное (-Rn’) рассчитывали как отрицательную первую производную Rn, генерируемую репортером во время ПЦР-амплификации. Зеленая кривая относится к образцу кДНК Volunteer U. Синяя кривая относится к кДНК SARS-CoV-2. Фиолетовая кривая соответствует состоянию без шаблона. Все данные представлены как среднее  ± S.E.M.

      Рис. 5: Разработка протокола мультиплексной ПЦР в реальном времени для обнаружения SARS-CoV-2.

      Результаты мультиплексной ПЦР в реальном времени для наборов праймеров SARS-CoV-2 SARS-CoV-2_IBS_E2, SARS-CoV-2_IBS_RdRP2, SARS-CoV-2_IBS_S2 и SARS-CoV-2_IBS_N1.Набор праймеров GAPDH использовали в качестве набора праймеров IPC. Графики слева представляют графики усиления. Графики справа представляют графики кривых плавления. Конечная концентрация смеси праймеров составляла 500 нМ. Зеленая кривая относится к образцу кДНК Volunteer U. Синяя кривая относится к кДНК SARS-CoV-2. Фиолетовая кривая соответствует состоянию без шаблона. Все данные представлены как среднее  ± S.E.M.

      Рис. 6: Оптимизация и разработка протокола мультиплексной ПЦР для обнаружения SARS-CoV-2.

      A , B , B , B , B Гель Электрофорез результаты из ПЦР с наборами грунтовки SARS_COV-2_IBS_M_IBS_M_RDRP 2, SARS_COV-2_IBS_M_S 1, SARS_COV-2_IBS_M_S 2, SARS_COV-2_IBS_M_N 1, SARS_COV-2_IBS_M_N 2, 18S RRNA , IBS_m_ACTB 1, IBS_m_ACTB 2, IBS_m_TBP 1 и IBS_m_TBP 2. Ожидаемые размеры продуктов ПЦР указаны в таблице 1. Voulteer U и реакции без матрицы с использованием смеси из четырех наборов праймеров для обнаружения c SARS-CoV-2 (SARS-CoV-2_IBS_E2, SARS-CoV-2_IBS_m_RdRP 1, SARS-CoV-2_IBS_m_S 1 и SARS-CoV-2_IBS_m_S 1 и SARS-CoV-2_IBS_m_RdRP 1 CoV-2_IBS_m_N 1). d Смесь трех наборов праймеров использовалась для обнаружения IPC человека (IBS_m_TBP 1, IBS_m_ACTB 1 и 18S рРНК). Расположение каждого предсказанного продукта ПЦР в геле указано справа.

      Разработка традиционного протокола ПЦР для обнаружения SARS-CoV-2

      Чтобы разработать традиционный протокол ПЦР для обнаружения SARS-CoV-2, который можно легко внедрить в любой биологической лаборатории по всему миру, мы разработали основанный на ПЦР протокол с использованием лучших наборов праймеров среди ранее разработанных наборов праймеров 9 после оптимизации каждого набора праймеров в соответствии с рекомендациями, показанными на рис.1а. Мы использовали кДНК SARS-CoV-2 в качестве положительного контроля, кДНК HEK-293T человеческого происхождения в качестве IPC человека и CDC_RNAae P (рис. 2d) в качестве контроля праймер-димер. Мы провели ПЦР (35 циклов) для каждого набора праймеров с использованием полимеразы Taq (рис. 3). Результаты электрофореза показали, что наборы праймеров SARS-CoV-2 SARS-CoV-2_IBS_E2, SARS-CoV-2_IBS_RdRP2, SARS-CoV-2_IBS_S2 и SARS-CoV-2_IBS_N1 давали только темные полосы соответствующих размеров (~100  п.н.). в присутствии матрицы кДНК SARS-CoV-2, а не в условиях кДНК HEK-293T или без матрицы (рис.3). Наборы праймеров IPC человека для SARS-CoV-2 показали мало признаков образования ложных полос праймер-димер (рис. 3), что указывает на то, что набор праймеров был сильно оптимизирован по сравнению с неоптимизированными наборами праймеров. Мы использовали праймеры GAPDH в качестве набора праймеров IPC человека и обнаружили, что, хотя наборы праймеров SARS-CoV-2 не давали обнаруживаемой полосы с кДНК HEK-293T, набор праймеров GAPDH давал положительную полосу в присутствии кДНК HEK-293T ( рис. 3). Результаты GAPDH показали, что кДНК HEK-293T была правильно приготовлена. Поскольку геномная РНК SARS-CoV-2 была первоначально получена из клеточной линии Vero, выделенной из эпителиальных клеток почек, выделенных из африканской зеленой мартышки ( макак-резус ) 19 , положительная полоса GAPDH, полученная в присутствии SARS- кДНК CoV-2 указывает на то, что кДНК клеток Vero была непреднамеренно включена в кДНК SARS-CoV-2 (рис. 3). Это было подтверждено с помощью инструмента ПЦР in silico, как показано на рис. 1а. В совокупности результаты показали, что мы разработали традиционный протокол обнаружения SARS-CoV-2 на основе ПЦР, который можно использовать во всем мире в любой биологической лаборатории, оснащенной обычным прибором для ПЦР.

      Улучшение протокола ПЦР в реальном времени для обнаружения SARS-CoV-2

      В нашем предыдущем отчете мы предоставили 9 уникальных наборов праймеров, нацеленных на SARS-CoV-2 9 . Однако эти наборы праймеров не были оптимизированы в соответствии с рекомендациями, показанными на рис. 1а. Поэтому в этом исследовании мы оптимизировали и выбрали лучшие наборы праймеров, пытаясь улучшить протокол ПЦР в реальном времени. Используя выбранные наборы праймеров для SARS-CoV-2_IBS_E2, SARS-CoV-2_IBS_RdRP2, SARS-CoV-2_IBS_S2 и SARS-CoV-2_IBS_N1, мы провели ПЦР в реальном времени для каждого набора праймеров и добровольца U или SARS-CoV- 2 образец кДНК или контроль без матрицы (фиг.4). Результаты ПЦР в реальном времени отображаются на двух отдельных графиках для каждого набора праймеров: графике амплификации и графике кривой плавления (рис. 4). График амплификации показывает изменение значений log (ΔRn) в зависимости от номера цикла ПЦР, тогда как график кривой плавления показывает динамику плавления при диссоциации нитей ДНК и последующем высвобождении ДНК, связанной с красителем SYBR® Green I 24 . Форма и положение этой кривой плавления ДНК зависят от соотношения GC/AT, длины и последовательности и могут использоваться для дифференциации ампликонов, разделенных менее чем на 2 °C при температуре плавления 24 . Результаты амплификации и график кривой плавления для каждого набора праймеров показали, что для всех четырех наборов праймеров SARS-CoV-2 (SARS-CoV2_IBS_RdRP2, SARS-CoV2_IBS_S2) при значениях C t менее 37 не было значительно положительного сигнала. , SARS-CoV2_IBS_E2 и SARS-CoV2_IBS_N1), тогда как был положительный сигнал для GAPDH при использовании кДНК образца Volunteer U (зеленая кривая, рис. 4; дополнительная таблица 1). Это резко контрастировало со значительно положительными сигналами, полученными с кДНК SARS-CoV-2 (синяя кривая, рис.4). Положительные сигналы на графике амплификации последовательно представлены острыми пиками на соответствующем графике кривой плавления (рис. 4). Расхождение между положениями пиков на кривых плавления GAPDH для образцов SARS-CoV-2 и добровольца U, скорее всего, было связано с 11-процентной разницей в последовательностях ампликонов между двумя видами приматов ( Homo sapiens и ). макак-резус ), на что указывает ПЦР in silico (дополнительная таблица 1). Для определения наличия SARS-CoV-2 мы использовали те же критерии, что и в предыдущей статье 9 : если обнаруживался любой из генов SARS-CoC-2, это записывалось как «SARS-CoV-2 обнаружен». », или, если обнаружен только человеческий ген IPC, это было записано как «SARS-CoV-2 НЕ обнаружен».Основываясь на этих результатах и ​​примененных критериях, мы пришли к выводу, что у волонтера U, скорее всего, был отрицательный результат на SARS-CoV-2. В совокупности эти результаты показывают, что использование оптимизированных наборов праймеров вместе с анализом кривой плавления может обеспечить улучшенный протокол обнаружения SARS-CoV-2 без ложноположительных результатов.

      Разработка протокола мультиплексной ПЦР в реальном времени для обнаружения SARS-CoV-2

      Используя оптимизированные наборы праймеров для ПЦР в реальном времени, мы попытались разработать альтернативный протокол обнаружения, приняв мультиплексную ПЦР в реальном времени, в которой все наборы праймеров смешивают в одном реакционном буфере. Разработав протокол для мультиплексной ПЦР в реальном времени, мы рассчитывали сократить необходимое количество образца и реагентов, время подготовки, стоимость и трудозатраты. Чтобы получить смесь набора праймеров, мы смешали все наборы праймеров, нацеленных на SARS-CoV-2, вместе в реакционном буфере, а набор праймеров IPC растворили отдельно в реакционном буфере. Таким образом, мы смогли сократить общее количество реакций с 15 до 6, приняв метод мультиплексирования. Чтобы уменьшить образование праймеров-димеров при смешивании всех наборов праймеров, мы пропорционально уменьшали концентрацию каждого набора праймеров, чтобы конечная концентрация всех наборов праймеров составляла 500 нМ (по 125 нМ каждого).В остальном процедура аналогична ПЦР в реальном времени. Мы получили очень похожие результаты на графиках амплификации для мультиплексной ПЦР в реальном времени (рис. 5) с результатами, полученными с помощью ПЦР в реальном времени (рис. 4). В частности, график амплификации показал одну комбинированную кривую реакции для всех четырех наборов праймеров со значительно более низким значением C t (рис. 5; дополнительная таблица 1) по сравнению с каждым набором праймеров (рис. 4). Точность эксперимента была подтверждена графиком кривой плавления, поскольку кривая плавления для положительного сигнала показывала несколько пиков, каждый из которых представлял каждый ампликон для соответствующего набора праймеров (рис.4, 5; Дополнительная таблица 1). Основываясь на этих результатах, мы пришли к выводу, что у волонтера U, скорее всего, будет отрицательный результат на SARS-CoV-2. В совокупности результаты показывают, что недавно разработанный мультиплексный протокол ПЦР в реальном времени можно использовать для быстрого и точного обнаружения SARS-CoV-2 в качестве экономически эффективной альтернативы протоколу ПЦР в реальном времени.

      Разработка протокола мультиплексной ПЦР для обнаружения SARS-CoV-2

      В качестве альтернативы традиционному протоколу на основе ПЦР мы дополнительно разработали протокол обнаружения SARS-CoV-2 на основе мультиплексной ПЦР, в котором все наборы праймеров были смешивают вместе в реакционном буфере. Чтобы визуализировать и разделить каждый ампликон каждого набора праймеров, мы разработали новые наборы праймеров, нацеленные на гены RdRP , S и N в геноме SARS-CoV-2, где каждый набор праймеров продуцировал ампликон другого размер (т. е. 200, 300 и 400 пар оснований соответственно). Для набора праймеров, нацеленных на ген E , был использован набор праймеров SARS-CoV-2_IBS_E2, о котором сообщалось ранее, с получением ампликона размером 116 пар оснований (таблица 1). Для наборов праймеров IPC человека мы аналогичным образом разработали новые наборы праймеров, нацеленные на 18 S рРНК , ACTB и TBP с размерами ампликонов 200 bp, 300 bp и 400 bp соответственно.Все наборы праймеров IPC человека включали последовательности праймеров, общие с африканской зеленой мартышкой ( макак-резус ), за исключением набора праймеров IBS_m_TBP1. Чтобы оптимизировать недавно разработанные наборы праймеров, мы провели ПЦР (35 циклов) с кДНК SARS-CoV-2 в качестве положительного контроля и кДНК HEK-293T человеческого происхождения в качестве IPC человека (рис. 6a, b). Результаты электрофореза показали положительные темные полосы соответствующего размера и отсутствие димеров праймеров в присутствии кДНК SARS-CoV-2 или HEK-293T, хотя некоторые наборы праймеров показали образование димеров праймеров в условиях отсутствия матрицы (рис.6а, б). Эти результаты показали, что все наборы праймеров были в высокой степени оптимизированы, демонстрируя высокую эффективность амплификации и низкую тенденцию к образованию собственного или гетеропраймера-димера. На основании низкого образования полос праймер-димер или их отсутствия и высокой интенсивности полосы ампликона мы выбрали следующие лучшие наборы праймеров для протокола обнаружения SARS-CoV-2 на основе мультиплексной ПЦР: SARS_CoV-2_IBS_m_RdRP 1 ( RdRP ), SARS_CoV- 2_IBS_m_S 1 ( S ), SARS_CoV-2_IBS_m_N 1 ( N ), 18S рРНК ( 18S рРНК ), IBS_m_ACTB 1 ( ACTB ) и IBS_m_ TBP 1.

      Используя наборы праймеров, выбранные на этапе оптимизации, мы затем провели мультиплексную ПЦР для обнаружения SARS-CoV-2. Для мультиплексной ПЦР мы смешали все наборы праймеров, нацеленных на SARS-CoV-2, вместе в реакционном буфере, а наборы праймеров IPC человека растворили отдельно в реакционном буфере, чтобы получить конечную общую концентрацию набора праймеров 500 нМ в обоих случаях. Результаты верхнего электрофореза показали четыре положительные полосы соответствующего размера для каждого набора праймеров SARS-CoV-2 на одной дорожке в присутствии кДНК SARS-CoV-2 (рис.6в). За исключением положительной полосы, полученной с набором праймеров SARS-CoV-2_IBS_E2, другие три набора праймеров давали положительные полосы высокой интенсивности (рис. 6c). Это согласуется с недавним сообщением о том, что экспрессия гена E в SARS-CoV-2 очень низкая 18 . Напротив, не было признаков положительной полосы в кДНК HEK-293T, кДНК Volunteer U или в условиях отсутствия матрицы (фиг. 6c). В соответствии с результатами, представленными на рис. 6а, б, не было признаков образования праймер-димера.Результаты электрофореза для наборов праймеров IPC человека показали, что была по крайней мере одна положительная полоса в условиях кДНК Volunteer U, HEK-293T и SARS-CoV-2, но не в условиях отсутствия матрицы (рис.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *