Для чего используется грунтовка: Все что важно знать о грунтовке


Грунтовка: для чего нужна и какую выбрать | Своими руками

Грунтовка: основа основ

Без должной обработки поверхности никакое покрытие на ней держаться не будет. О том, какую функцию выполняют грунтовки, какие из них подходят для каких целей, пойдёт речь в этом обзоре.

Грунтовке отделываемой поверхности придаётся подчас меньшее значение, чем последующей финишной отделке. А это грубая ошибка! Чтобы краска или обои долго держались на стене, её нужно тщательно подготовить. Грунтовки в этом процессе могут выполнять различные задачи.

Основные функции грунтовки

Во-первых, грунтовка играет роль связующей субстанции между основанием и финишным покрытием. Чем больше точек сцепления находят краска или лак, тем крепче они держатся. Поверхность при обработке грунтовкой становится не гладкой, как могло бы показаться, а наоборот, обретает микроскопическую шероховатость, неощутимую на ощупь. Во-вторых, грунтовки укрепляют основание.

Это особенно важно при обработке стен, покрытых штукатуркой, в которой добавка – как правило, песок – выступает на поверхность и начинает осыпаться. Но если в обильно обработать такую поверхность грунтовкой глубокого проникновения, то основание стабилизируется и становится пригодным для нанесения любого финишного покрытия.

Третья функция хорошей грунтовки – понижение впитывающей способности основания. Для этой цели используют грунтовки глубокого проникновения, заполняющие мельчайшие поры минеральных материалов, дерева и плотно закупоривающие их. Особая роль отводится грунтовкам при обработке поверхностей, в которых присутствуют сразу несколько различных материалов – например, если известково-цементная штукатурка подправлена гипсовой шпатлёвкой.

В этом случае грунтовка глубокого проникновения способствует выравниванию впитывающей способности разных материалов и нанесённая на них затем краска будет держаться одинаково хорошо. В противном случае на окрашенной поверхности возможно появление пятен.

Наконец грунтовка призвана оказывать изолирующее и импрегнирующее действие на основание. Изолирующая грунтовка не даёт некоторым веществам, например пигментам или смолам, выйти из основания на поверхность и образовать пятна и цветные разводы. Импрегнирующая грунтовка защищает основание от проникновения в него жидкостей. Особенно это важно при обработке внешних деревянных поверхностей, подвергающихся атмосферному воздействию.

Антисептические грунтовки

Эти бесцветные грунты противодействуют проникновению влаги в древесину, тем самым защищая её от гниения и грибка, вызывающего синеву. При работе с хвойными породами дерева, прежде всего с сосной, такая обработка – абсолютный минимум из того, что нужно сделать, чтобы защитить дерево от атмосферного воздействия. Сам грибок не оказывает разрушающего воздействия на дерево, он лишь увеличивает его способность поглощать воду приблизительно в два раза, в результате чего на дереве появляются некрасивые сине-серые пятна и разводы.

Грунтовки содержат биоциды, поэтому использовать их следует с осторожностью. Вещества, предохраняющие дерево от синевы, входят в состав многих других грунтовок по дереву.

Импрегнирующие грунтовки

Бесцветные грунтовки выполняют множество функций – защищают дерево от проникновения воды и насекомых, предотвращают его гниение и появление синевы. Их используют прежде всего в деревянных конструкциях, подвергающихся усиленным статическим нагрузкам, – например, на стропилах.

Ссылка по теме: Строительные смеси для грунтовки, затирки, выравнивания пола и стен и укладки плитки в вопросах и ответах

Изолирующие грунтовки

Эти грунтовки содержат белый пигмент и призваны защищать не само деревянное изделие, а, наоборот, финишное покрытие от веществ, которые со временем могут выйти из древесины на поверхность и образовать там пятна.

В такой обработке нуждаются прежде всего сорта древесины с большим содержанием разных веществ, в том числе эфирных масел – например, лиственница и тропические виды.

Рекомендуется обработать изолирующей грунтовкой и термодревесину.

Грунтовки для МДФ

Широко используемые при изготовлении мебели панели МДФ нуждаются в особой грунтовке. В работе с МДФ сталкиваются с двумя проблемами. Во-первых, поверхности панелей МДФ -чрезвычайно гладкие, и это уменьшает адгезию лакокрасочного покрытия. Грунтовка же выполняют функцию вещества, улучшающего сцепление.

Во-вторых, торцевые края панелей МДФ обладают повышенной впитывающей способностью – и грунтовка призвана понизить её. Грунтовку для МДФ, почти как все грунтовки для внутренних работ, наносят валиком для лаков и эмалей. Торцевые края лучше всего покрыть двумя слоями грунтовки.

Грунтовки для предварительной окраски

Чтобы при работах внутри помещения получить идеальную глянцевую поверхность, необходимо окрашиваемый объект предварительно покрыть грунтовочной краской. На дереве белая грунтовочная краска заполняет поры и создаёт поверхность с микроскопической шероховатостью. Именно эта структура обеспечивает последующему лакокрасочному покрытию идеальную адгезию. Кстати, грунтовочные краски выпускаются не только для дерева, но и для металла и твёрдых пластмасс.

Быстрошлифуемый грунт

Этот быстросохнущий грунт используется для обработки мебели. Его производят на основе искусственной смолы. Грунт – бесцветный, обладает хорошим наполняющим эффектом и улучшает адгезию последующего лакового покрытия. Однако это средство может использоваться только с нитро-и универсальными лаками. Годится для всех сортов древесины.

Грунтовки глубокого проникновения

Почти на всех минеральных основаниях внутри помещения применяют эти бесцветные грунтовки. Они ослабляют впитывающую способность основания и выравнивают эту способность, если в основании присутствуют несколько материалов, например при работе с гипсокартоном.

Обладающие мелкопористой структурой гипсокартонные панели и более грубая шпатлёвка на стыках по-разному впитывают краску или обойный клей, что впоследствии может проявиться на финишной окраске или на обоях.

Грунтовка же помогает этого не допустить. А ещё грунтовки делают основание более плотным и связывают остаточную пыль. Грунтовки глубокого проникновения обильно наносят широкой кистью, на сильно впитывающих поверхностях – в два слоя.

Штукатурные грунтовки

По своим функциям эти грунтовки близки к блокирующим грунтовкам: они тоже призваны противодействовать проникновению пигментов из основания. Но благодаря своей мелкозернистой структуре они обеспечивают лучшее сцепление штукатурки с основанием. Существуют грунтовки для тонко- и толстослойных штукатурок.

Грунтовки для невпитывающих оснований

Идеальны для особо сложных оснований. Это прежде всего невпитывающие материалы и деревянные поверхности внутри помещений.

Речь идёт о половых досках, древесностружечных плитах и панелях ОСП, которые нужно соединить с цементной массой – например, с выравнивающей смесью для пола или плиточным клеем. В этом случае грунтовки служат и своего рода влагонепроницаемыми покрытиями, противодействующими набуханию древесины.

Грунтовки бетоноконтакт

Если в процессе строительства или ремонта возникает необходимость приклеить обычным кле-кафель к металлу, дереву или даже к уже уложенной плитке, то для обработки основания используют грунтовки бетоноконтакт. Их назначение – увеличить адгезию поверхностей, имеющих плохую способность впитывать влагу.

Гидроизоляция для душа

Эти водопроницаемые эластичные средства можно накосить валиком почти на все минеральные основания, конкретно – под плитку в местах попадания водяных брызг. Покрытия эластичны и без проблем выдерживают подвижки материалов, вызываемые изменениями температуры.

Антикоррозийные грунтовки

Эти средства способствуют лучшей адгезии лакокрасочного покрытия и металла. Кроме того, они препятствуют невидимой коррозии металла под лакокрасочным покрытием. Поэтому, работая с металлом, важно каждое место на объекте покрыть толстым слоем такой грунтовки. Антикоррозийные грунтовки производятся на основе акрила, искусственной смолы, масла и смесей этих веществ. Но все они действуют одинаково. Перед нанесением грунтовки основание необходимо очистить от ржавчины металлической щёткой или наждачной бумагой.

Протекторные грунтовки

Протекторные грунтовки состоят из порошка свинца, цинка и сплава магния с цинком. На поверхности они создают невидимую плёнку. Частицы цинка, входящие в состав грунта, защищают металлическое основание даже при образовании царапин.

Преобразователи ржавчины

Такие грунтовки тоже увеличивают адгезию краски на металле и защищают его от ржавчины. Однако в отличие от антикоррозийной грунтовки их можно наносить непосредственно на небольшие заржавленные участки. Ржавчину при этом удалять не требуется. Вещества, содержащиеся в грунтовке, вступают с окисью железа в химическую реакцию. благодаря чему она превращается в основание, вполне пригодное для последующего лакокрасочного покрытия. Во время этой реакции преобразователь ржавчины окрашивается в сине-чёрный цвет. Это изменение цвета – признак того, что процесс преобразования произошёл. Если же цвет не изменился, то нужно нанести средство ещё раз.

Изолирующие грунтовки

Алкидные и эпоксидные грунтовки предназначены для защиты металлического основания от кислорода и влаги. Они состоят из наполнителей, цинковых белил и железного сурика. Используются чаще всего для чёрных металлов.

Читайте также: Грунтовка и покраска ржавого участка кузова машины своими руками

Грунтовки для цветных металлов

В повседневной жизни эти грунты применяют в работе с такими цветными металлами, как медь, алюминий, бронза и цинк, а также с оцинкованной и нержавеющей сталью. Эти водорастворимые грунтовки улучшают адгезию между гладкой поверхностью цветного или нержавеющего металла с последующим лакокрасочным покрытием – например, с цветным или прозрачным защитным лаком. Предохранять большинство цветных металлов от коррозии нет необходимости: медь, скажем, защищает себя сама. Со временем на её поверхности под воздействием воздуха образуется характерная зелёная окисно-карбонатная плёнка (патина).

Одним махом

Большинство грунтовок наносят для образования промежуточного слоя, увеличивающего адгезию для следующих слоев отделки, но некоторые можно использовать в качестве глянцевого финишного покрытия. Сейчас на рынке присутствуют продукты 2 в 1 и даже 3 в 1, объединяющие в себе грунтовку, финишное покрытие и, например, защиту от ржавчины, что позволяет экономить деньги, место и время. Однако результат использования универсальных средств будет, увы, не на том же уровне, как от применения специализированных покрытий для каждой операции.

Лучше работать на воздухе!

Многие грунтовки содержат химические вещества, которые не должны попадать на кожу, а их пары нельзя вдыхать. Некоторые грунтовки огнеопасны. Поэтому при работе с ними внутри помещения рекомендуется хорошо его проветривать, надевать резиновые перчатки, а то и респираторы. Идеально, если объект можно вынести из дома и работать под открытым небом. Если же приходится работать над чем-то, что находится у вас над головой, то следует надеть защитные очки, чтобы ничто не попало в глаза.

Грунтовка проблемных и «трудных» стен – видео


Ниже другие записи по теме «Как сделать своими руками — домохозяину!»

Подпишитесь на обновления в наших группах и поделитесь.

Будем друзьями!

Для чего применяют грунтовку?

Благодаря обработке поверхности грунтовкой перед началом отделки можно защитить ее от грибка и увеличить срок службы покрытия. 

Зачем нужна грунтовка?

Грунтовка – специальный состав, который наносят на поверхность перед дальнейшей отделкой. Она бывает двух видов – сухая смесь и жидкий состав.

Средство применяют для устранения небольших изъянов поверхности и адгезии с последующими слоями отделки. Помимо этого, оно защищает поверхность от грибка и плесени. После нанесения на поверхности образуется пленка из полимеров.

Каждая смесь имеет индивидуальный состав, придающий средству то или иное свойство. Кроме того, отдельные составляющие способствуют скорейшему высыханию грунтовки.

Классификация средства

На рынке можно встретить следующие составы для грунтования:

  1. Глубокого проникновения. Основа этого средства – акриловые сополимеры. Именно они проникают вглубь поверхности и сцепляют все частицы. После обработки таким средством возрастает прочность поверхности, и увеличивается адгезия с последующими слоями. Количество впитываемой влаги при этом уменьшается. Такой вид грунта чаще используют в быту.
  2. Алкидные грунты. Этот тип средства подходит практически для любой поверхности. Но он считается токсичным и имеет неприятный запах.
  3. Универсальная грунтовка. Данный вариант используют при завершении отделки. Он предназначен для увеличения стойкости к влаге, практически не имеет запаха, быстро сохнет. Кроме того, некоторые грунты содержат антибактериальные компоненты, которые предотвращают появление грибка.
  4. Бетоноконтактная грунтовка не проникает внутрь поверхности, создавая неровное покрытие по типу наждачной бумаги. Такое средство значительно увеличивает адгезию между поверхностью и последующими слоями. Состав наносят только на ту основу, которая не требует дополнительного укрепления.
  5. Фасадная грунтовка применяется для наружных работ. Она отличается высокой плотностью и улучшенными показателями влаго- и морозостойкости.

Технология нанесения

Перед нанесением грунтовки поверхность необходимо очистить от пыли и грязи. После этого готовый раствор распределяют валиком или щеткой, оставив до полного высыхания. Затем идет следующий слой.

Если смесь наносится между слоями отделки, то стоит подождать полного высыхания предыдущего средства. К таким смесям относятся штукатурка или шпаклевка. Эта технология увеличивает сцепление между слоями и предотвращает расслаивание.

Грунтовка незаменима во время ремонта. Так как она существенно продлевает срок службы последующего отделочного слоя. При выборе средства стоит уделить отдельное внимание токсичности материала и его основе.

Для чего нужна прозрачная грунтовка и как ее выбрать?

Блок: 1/10 | Кол-во символов: 151
Источник: https://www.ivd.ru/stroitelstvo-i-remont/otdelocnye-materialy/gruntovka-sten-pod-oboi-kak-pravilno-ee-vybrat-i-ispolzovat-37231

Hidroten прозрачная грунтовка

ОПИСАНИЕ: Прозрачная грунтовка на акрилсополимерной основе, для применения на внутренних стенах.

ОСОБЕННОСТИ:Готова к употреблению. Не имея в структуре состава, заполняющего неровности, хорошо впитывается в поверхность, увеличивает сохранность наносимой краски, и, уменьшая впитываемость поверхности, одновременно уменьшает и количество потребления завершающего слоя. Подобная грунтовка способствует хорошему закреплению завершающего слоя.

ОБЛАСТЬ ПРИМЕНЕНИЯ: Применяется в качестве грунтовки на поверхностях, выровненных пластической замазкой DYORIT, поверхностях, окрашенных старой краской на эмульсионной основе, или на новых поверхностях, с повышенной впитываемостью, до применения завершающей краски.

СПОСОБ ПРИМЕНЕНИЯ: Готово к употреблению. Нет необходимости разбавлять. Потрескавшиеся, слабые поверхности должны быть очищены, грязь и жир должны быть удалены. Применяется кистью или валиком в один или два слоя, в зависимости от состояния поверхности.

ДОПОЛНИТЕЛЬНАЯ ИНФОРМАЦИЯ:Фасовка 4 и 17,5 литров. Рекомендуется применять перед использованием водоэмульсионной краски HIDROTEN.

ВРЕМЯ ВЫСЫХАНИЯ: (при температуре +25°С) Через 15 минут можно прикасаться, через 30 минут не пристает пыль, полное высыхание — 6 часов.

РАСХОД: 1 л на 10-14 кв. м в зависимости от впитываемости поверхности.

ПРИМЕЧАНИЕ: Температура окрашиваемой поверхности должна превышать +5oС.

СРОК ХРАНЕНИЯ: Минимум 3 года (при температуре выше +5°С).


Блок: 2/4 | Кол-во символов: 1499
Источник: http://shpatlevko. ru/page/gruntovka-prozrachnaja

Готовим стены под обои:

Что такое грунтовка
Зачем она нужна
Какую выбрать:

Нормы расхода
Чем наносить
Порядок работы
Время высыхания
Как хранить

Приступая к поклейке обоев, базовую основу необходимо обработать. Любой мастер скажет, что грунтование — обязательный этап. Но люди, далекие от ремонта, вряд ли ответят на вопрос, для чего это делается. Ведь видимого эффекта от этого нет. А если делать нужно, то как ее выбрать? На полках строительных магазинов просто пугающий ассортимент банок, канистр и ведерок. Разберемся, как найти подходящую грунтовку для стен под обои, правильно нанести, и какие тонкости при этом учесть.

Блок: 2/10 | Кол-во символов: 810
Источник: https://www.ivd.ru/stroitelstvo-i-remont/otdelocnye-materialy/gruntovka-sten-pod-oboi-kak-pravilno-ee-vybrat-i-ispolzovat-37231

Храктеристики грунтовки

Преимущества грунтовки
  1. Снижает расход краски
  2. Обеспечивает качественное наложение ЛКМ и прочность ее прикрепления к поверхности
  3. Обеспечивает равномерность окраски
  4. Почти полностью исключает трещины на краске
  5. Исключает процесс отхода наклеенных обоев от стены
  6. Исключает возможность непрочного крепления кафельной плитки
  7. Обеспечивает гладкость окрашенной поверхности.
  8. Исключает проявление пятен после покраски
  9. Обеспечивает блеск глянца
  10. Избавляет от химического запаха во время покраски
  11. Позволяет перекрасить из темного цвета в светлый
  12. Модифицирует ржавчину в защитный слой.
  13. Предотвращает заплесневение и гнилостные процессы
  14. Создает водоотталкивающую пленку на предмете
Поверхности для грунтовки:
  1. Кирпич
  2. Бетон монолит
  3. Цемент
  4. Блок пенобетонный
  5. Стяжка ангидридная
  6. Штукатурка
  7. ДВП, ДСП
  8. Гипсокартон листовой
После грунтовки проводят следующие работы:
  1. Шпаклевание
  2. Оштукатуривание
  3. Окрашивание
  4. Покрытие гидроизоляционными смесями
  5. Нанесение напольных смесей
  6. Наклейка обоев
  7. Крепление облицовочной плитки.
Поверхности, которые подлежат грунтовке:
  1. Пол
  2. Стены
  3. Потолок
  4. Металлоконструкции

    Инструмент для грунтовки:
    1. Кисти, валики
    2. Распылитель
    3. Наждак мелкий, машина шлифовальная
    4. Скребок, шпатель
    5. Шпаклевка
    6. Смывка
    7. Ванночка для состава
    8. Средства защиты: очки, перчатки

    Расход идет из расчета примерно 150 мл на 1 метр квадратный поверхности.

    Правила нанесения грунтовки:
    1. Очистка основы от всех посторонних элементов механическим воздействием или смывкой. Неровности до 1,5 выравнивать шпатлевкой и сушить до 1 недели.
    2. При желании шлифовка шлифовальной машиной или наждаком.
    3. Наложение грунта.
      • налить ее в посуду, окунуть в нее кисть или валик
      • нанести ее на основу, углы и за батареями
      • Дождаться полного высыхания слоя. Неблагоприятны низкая температура и высокая влажность. Оптимальна температура около 20 градусов С.
      • после высыхания второго слоя надо сразу применить ЛКМ
      • рыхлое основание, как, например, пенобетон нуждается в большем количестве продукта.

    Меры безопосности при нанесении грунтовки:

    1. Защищать глаза и руки очками и перчатками
    2. Помнить о возможности аллергической реакции
    3. Избегать попадания ее на тело, т.к. она плохо смывается.

    Взаимодействие с разными поверхностями:

    1. Бетон. Лучше всего употреблять проникающую, особенно перед нанесением самовыравнивающей смеси для пола.
    2. Дерево, гипс. Защита от воды.
    3. Гладкие поверхности. От гладкой легко отпадают отделочные материалы. Требуется специальная грунтовка с кварцевым песком для удержания отделки.
    4. Защита от бактерий и плесени. Требуется с антигрибковыми и антибактериальными добавками. При появлении плесени хотя бы на одном участке надо обработать все стены с целью защиты.

    Особенности работы с различными видами грунтовок

    1. Кварцевая. Наносится на гипсокартонные стены, поверх первого слоя наносится слой шпаклевки, затем на шпаклевку кладется второй слой, а затем применяется ЛКМ. Цвет ее должен соответствовать цвету краски.
    2. Бетоноконтакт. Для плотных невпитывающих изделий, как блоки, стены, потолки, монолит. Перед оштукатуриванием необходимо обработать их бетоноконтактом.
    3. Ее не могут заменить дисперсии из полимера или водоэмульсионные краски, при их употреблении неизбежен бракованный результат.

    Производители лучших грунтовок:

        • Тиккурила, Финляндия
        • Sherwin-Williams, USA
        • Финнколор, Россия
        • Beckers, Швеция
        • Хенкель Баутехник (Ceresit СТ 17)
        • Dali грунт-эмаль по ржавчине
        • Olympic (Acryl Grundierung)
        • Беларусь (Belinka)

    Лучше брать грунтовки и сухие смеси от одного производителя, они лучше сочетаются.

    Фасовка грунтовки

    Готовые смеси, неразбавленные концентраты и сухие смеси, иногда баллоны.

    Это наиболее необходимые знания о ней для людей, любящих ремонт. Успеха Вам, работы без выбраковки, правильного Вам подбора сочетаний отделочных изделий!

    материалы по теме

    Грунтовка для судов, предназначенная для текущего ремонта

    Бизнес морских покрытий AkzoNobel объявил о выпуске новой антикоррозийной грунтовки, разработанной, чтобы поддерживать упрощенный текущий ремонт, безотходное производство и потребление, а также улучшить защиту от коррозии.

    Ни один профессиональный маляр не нанесет краску на неподготовленную поверхность. Перед тем как окрасить стены, потолки или другие элементы строения, их нужно загрунтовать, то есть нанести специальный состав, чтобы краска лучше и ровнее легла на поверхность. Какую грунтовку выбрать – зависит от материала покрытия. О видах грунтовок и их применении в малярных работах вы узнаете из этого обзора.

    Грунтовки, или огрунтовочные составы, — это жидкости, обладающие хорошим сцеплением с поверхностью. Одно из основных назначений грунтовок всех видов – создание на поверхности водонепроницаемой пленки.

    В малярном деле грунтовки используют перед окрашиванием, что позволяет наносить краску ровным слоем и легко ее растушевывать. Если поверхность не обработать грунтовкой, колер будет впитываться неоднородно и это приведет к тому, что краска ляжет неравномерно — полосами и пятнами.

    Существует множество типов грунтовок: одни из них можно использовать под известь, другие — под клеевую краску. Существуют и универсальные составы, которые можно применять с любым видом краски.

    О том, какая грунтовка лучше для той или иной поверхности, читайте ниже.

    Блок: 6/15 | Кол-во символов: 4716
    Источник: https://maljarblog.ru/gruntovki/vidyi-gruntovok/bestsvetnaya-gruntovka-vidy-i-svojstva.html

    Грунтовка глубокого проникновения: как она работает?

    После нанесения на поверхность грунтовка, проникнув в толщу за счет наличия в ее составе акриловых полимеров, начинает формировать решетку из кристаллов, в которую «склеены» все мелкие и разрозненные частицы основания.

    Важной отличительной особенностью данного состава является то, что обработанные поверхности не утрачивают своей паропроницаемости. Этот факт важен, когда рассматриваются разные виды грунтовок для стен, обладающих данной характеристикой.

    Продукция разных производителей может отличаться по составу, но основные компоненты неизменны.

    Итак, грунтовка глубокого проникновения это:

    • вода – часто составляет до 70% объема, в концентрированных составах ее доля меньше;
    • связующий компонент, в роли которого выступает акрил;
    • полимеры, функция которых сводится к повышению впитывающей способности поверхности;
    • антисептики (фунгициды), поэтому если необходима антигрибковая грунтовка глубокого проникновения, то следует удостовериться, что в ее составе присутствует этот компонент;
    • силиконовая добавка, отвечающая за водопоглощение уже обработанной поверхности;
    • латексные компоненты, влияющие на адгезивные характеристики грунтовочного состава.

    Грунтовки, выпускаемые в виде концентратов, непосредственно перед нанесением разводятся водой в строгой пропорции, указанной в инструкции, как правило, данный показатель варьируется от 1:1 до 1:5.

    Впитывающая способность поверхностей, естественно, влияет на расход материала, но данный показатель также находится в зависимости от индивидуального состава конкретного вида.

    Какой производитель лучше?

    Например, грунтовка глубокого проникновения для бетона или аналогичного пористого материала от Церезит, например СТ 17, имеет расход от 100-200 мл/м2, а с аналогичными характеристиками от Кнауф всего 70-100 мл/м2.

    Продукция российских производителей от торговых марок Оптимист и Старатели показывает расход от 80 до 250 мл/м2, при этом обладая сравнимыми характеристиками с зарубежными аналогами.

    Все эти виды рекомендованы для обработки одних и тех же поверхностей: бетона, штукатурки, гипсокартона, дерева, кирпича.

    Также мало отличается стоимость грунтовки глубокого проникновения, выпущенная Церезитом или Оптимистом, а вот Кнауф хоть и незначительно, но дороже.

    Время высыхания поверхности хоть и незначительно, но отличается в зависимости от вида нанесенного состава: для Кнауф, Старатели, Оптимист этот параметр колеблется от 2 до 3 часов, а для Церезита – от 4 до 6 часов.

    Конечно, то, сколько сохнет грунтовка, зависит не только от производителя, но и от температуры окружающего воздуха и, особенно, влажности, а также от глубины проникновения в основание. При этом рекомендуемая рабочая температура для всех грунтовочных составов колеблется в пределах от 5 до 30-35 °C.

    Блок: 5/6 | Кол-во символов: 2829
    Источник: https://relend.ru/gruntovka-glubokogo-proniknoveniya-kakaya-luchshe-raschod-vidy-sten.html

    Виды грунтовок для дерева

    Существует несколько видов грунтовок, подходящих для обработки деревянных поверхностей. Некоторые из них представляют водорастворимые составы, смешиваемые с теплой водой. Другие смеси являются водонепроницаемыми.

    Водорастворимые грунты защищают древесину от коррозии (то есть разрушения), а водонепроницаемые составы обеспечивают отталкивание влаги. Последнее качество особенно важно, если деревянное изделие используется на открытом воздухе.

    Для дерева чаще всего используются такие грунтовки:

    1. Масляные составы. Используются для грунтования ранее окрашенного дерева или для пропитки древесины. Такая смесь наносится в один слой.
    2. Акриловые грунты. Наносятся в несколько слоев. Достоинство акрила — быстрое высыхание (1-5 часов), отсутствие неприятного запаха, экологическая безопасность.
    3. Глифталевые грунты. Сохнут в течение суток. Недостаток таких смесей — их неэффективность при обработке поверхностей, которые будут эксплуатироваться в условиях повышенной влажности.
    4. Алкидные составы. Лучше всего их применять, если поверхность ранее не окрашивалась. Если в составе алкидной грунтовки есть пигмент, древесина приобретет матовый оттенок. Такого эффекта добиваются при желании подчеркнуть финишный цвет. Время сушки — 12-16 часов.
    5. Шеллаковые грунты. Хорошо показывают себя, если задача — сгладить поверхность и изолировать места с выступающей смолой. Кроме того, применяются как изолятор для водорастворимых морилок.
    6. Полиуретановые и эпоксидные составы. Чаще всего это краски, включающие растворители. Это возможный, но не лучший вариант для обработки деревянной поверхности.

    Блок: 14/15 | Кол-во символов: 1593
    Источник: https://maljarblog.ru/gruntovki/vidyi-gruntovok/bestsvetnaya-gruntovka-vidy-i-svojstva.html

    Нормы расхода раствора

    Расход грунта обычно указывается на упаковке в расчете на 1 квадратный метр плоскости. Он зависит от впитывающих способностей основы и вида грунта.

    Вид Расходная норма, гр
    Бетоноконтакт 350
    Глубокого проникновения 100-200
    Универсальная акриловая 100-150
    Латексная 100-150
    Минеральная 200-300
    Алкидная для дерева 100-130


    У бетоноконтакта расход выше, чем у обычного грунта, но так как он не впитывается, второй слой делать не требуется. Больше — не значит лучше. Если не соблюдать заявленные производителем нормы и расходовать больше, то это приведет к увеличению сроков высыхания, что может затянуть ремонт надолго. Оптимальным считается результат грунтования в виде блестящей полимерной пленки.

    Блок: 6/10 | Кол-во символов: 819
    Источник: https://www.ivd.ru/stroitelstvo-i-remont/otdelocnye-materialy/gruntovka-sten-pod-oboi-kak-pravilno-ee-vybrat-i-ispolzovat-37231

    Чем наносить грунтовку для стен под обои

    Для работы нужны следующие инструменты.

    • Емкость для раствора.
    • Валик. Чтобы дотянуться до верхнего края, понадобится валик на длинной ручке. Удобно приобрести модель с телескопической ручкой. Лучше выбрать полиамидный валик со средним или коротким ворсом.
    • Кисть для углов и труднодоступных мест. Лучше выбирать широкую мягкую модель с длинным ворсом.
    • Пульверизатор — если вам удобнее пользоваться им, а не валиком. При этом нужно подумать о защите глаз и дыхательных путей, надев респиратор и строительные очки.

    На бетон или цемент грунт советуют наносить кистью. На шпатлеванную поверхность — пульверизатором. А гипсокартон лучше красить велюровым валиком.

    Блок: 7/10 | Кол-во символов: 712
    Источник: https://www.ivd.ru/stroitelstvo-i-remont/otdelocnye-materialy/gruntovka-sten-pod-oboi-kak-pravilno-ee-vybrat-i-ispolzovat-37231

    Свойства грунтовок

    Грунтующий состав обеспечивает проникновение в структуру материала и его укрепление. За счет грунтования на деревянной поверхности образуется водонепроницаемая пленка, предохраняющая древесину от негативного воздействия влажности.

    Если деревянное изделие не защищено, рано или поздно оно начнет гнить. К тому же, грунт сокращает расход краски или лака, что при больших объемах обрабатываемой поверхности дает существенную экономию.

    Грунтовка представляет собой основание для нанесения на него отделочного материала (лака, краски и т.д.).

    Утверждения о том, что грунтование можно заменить краской с растворителем — неверны. Такой вариант не обеспечит защиты древесине и, к тому же, обойдется дороже, поскольку расход краски будет выше, чем с прогрунтованной поверхностью.

    Грунтовка (за исключением аэрозолей) наносится на дерево с помощью валика или кисти.

    Блок: 2/4 | Кол-во символов: 878
    Источник: https://www.sehndvichpaneli.ru/dlya-chego-nuzhna-prozrachnaya-gruntovka-i-kak-ee-vybrat/

    Какую грунтовку лучше использовать перед окрашиванием?

    А какую грунтовку лучше использовать перед окрашиванием минеральных поверхностей и «придания шероховатости»?

    Адгезионные грунтовки предназначены для создания шероховатой поверхности. Таким образом, старый и новый слои покрытия наилучшим образом сцепляются один с другим.

    В составе грунтовки для повышения ее адгезионных свойств присутствует кварцевый песок, поэтому после ее нанесения поверхность напоминает наждачную бумагу

    Особенно часто адгезионные грунтовки применяют под такие «тяжеловесные» виды штукатурки, как «барашек» » и «короед». Адгезионная грунтовка может быть как белой, так и цветной. Цветные грунтовки используются под минеральную штукатурку, чтобы сквозь нее не просвечивала поверхность стены.

    Минеральные грунтовки обычно используют для нанесения на кирпич, бетон, газосиликатные блоки и другие виды минеральных поверхностей. В качестве связующего вещества в их составе выступает цемент.

    Также выпускаются грунтовки перхлорвиниловые, фенольные и полистирольные. Но из-за высокой токсичности они используются только для промышленных нужд.

    Грунтовку можно изготовить своими руками, а также использовать в этом качестве неразведённую олифу.

    Для того чтобы избежать пропусков при нанесении грунтовочного слоя, в олифу можно добавить немного пигмента (до 10% от объема). Если же ее прогреть, то проникновение будет более глубоким.

    Блок: 8/15 | Кол-во символов: 1391
    Источник: https://maljarblog.ru/gruntovki/vidyi-gruntovok/bestsvetnaya-gruntovka-vidy-i-svojstva. html

    Порядок работы

    Перед тем как начинать загрунтовывать основу, ее необходимо очистить от старых покрытий, жировых и масляных пятен, плесени и грязи. Убрать или закрыть розетки, выключатели и стекла, чтобы раствор не попал на них. Смыть его после высыхания будет невозможно, придется заменять.

    С помощью шпатлевки выровнять стены. Налить ее в кювету и равномерно пропитать валик или кисточку. Затем наносить на чистую плоскость. Начинать лучше от окна комнаты.

    Блок: 8/10 | Кол-во символов: 466
    Источник: https://www.ivd.ru/stroitelstvo-i-remont/otdelocnye-materialy/gruntovka-sten-pod-oboi-kak-pravilno-ee-vybrat-i-ispolzovat-37231

    Грунты бесцветные

    Бесцветная, глубокопроникающая, акриловая грунтовка для подготовки основания перед оштукатуриванием. Применяется для внутренних и наружных работ, разбавляется водой.

    Д 314, ГРУНТ (D 314 Tiefgrund LF)

    Разбавляемая водой, бесцветная грунтовка глубокого проникновения на основе акрил-гидрозоля для подготовки основания перед окраской. Для наружных и внутренних работ. Д 315, Грунт (D 315 Tiefgrund TB)

    Содержащая растворитель, бесцветная грунтовка глубокого проникновения. Для наружных работ. Предназначена для снижения и выравнивания впитывающей способности оснований, а также для их укрепления. Повышает адгезию последующего покрытия, скрепляет все минеральные основы. Быстро высыхает, после высыхания не липнет, пропускает водяной пар.

    ГРУНТ-КОНЦЕНТРАТ, Р 805 (Grundierkonzentrat P 805)

    Высококонцeнтрированный грунт для внутрeнних и наружных работ. Спeциальный грунт для выравнивания впитывающeй способности оснований, таких как, гипсокартон, гипсовыe штукатурки и т. п. Спeциально прeдназначeн для газобeтонных повeрхностeй и нeжжeнных кирпичeй. Со слабым запахом, лeгко обрабатываeтся.


    Акрил-гидрозоль, грунт для внутрeнних и наружных работ. Разбавляeмый водой, паропроницаeмый, чрeзвычайно тонкодиспeрсионный спeциальный грунт для укрeплeния и выравнивания впитывающeй способности гипсосодeржащих оснований, лeгкомeлящихся штукатурок и бeтонных повeрхностeй, улучшаeт адгeзионныe свойства, идeалeн для жилых помeщeний и помeщeний, связанных с продуктами питания, бeсцвeтный послe высыхания. ГРУНТ, Р 820 (Putzgrund P 820)

    Готовая к использованию спeциальная грунтовка на акриловой основe, для внутрeнних и наружных работ Для экономичной обработки сильно впитывающих влагу или имeющих различную впитывающую способность минeральных оснований. Атмосфeростойкая, высокая стeпeнь проникновeния, растворяeтся водой, экологичeски бeзопасная, со слабым запахом.

    Блок: 9/15 | Кол-во символов: 1921
    Источник: https://maljarblog.ru/gruntovki/vidyi-gruntovok/bestsvetnaya-gruntovka-vidy-i-svojstva.html

    Время высыхания

    Многих интересует вопрос, через сколько времени можно клеить обои после грунтовки. Это напрямую зависит от процентного соотношения воды в составе смеси. Имеют значение и другие показатели: оптимальная температура в комнате — 20 градусов тепла, атмосферная влажность — 70%.

    Лучше всего соблюдать указанные на этикетке сроки высыхания, так как при похожем названии у разных производителей в растворе могут содержаться специальные вещества, влияющие на скорость высыхания. Примерное время для просушки разных материалов представлено в таблице.

    Вид Поверхность Время
    Бетоноконтакт все 6 ч
    Латексная все 40 мин
    Универсальная акриловая бетон от 1 до 3 ч
    гипсокартон 12 ч
    кирпич от 6 до 8 ч
    штукатурка от 2 до 4 ч
    Грунтовка глубокого проникновения все 24 ч
    Минеральная бетон от 2 до 6 ч
    Алкидная дерево 10-12 ч
    металл 10-15 ч
    Глифталевая металл 24 ч

    Основные ошибки, допускаемые при просушке:

    • сквозняки — открытые окна и двери спровоцируют неравномерное высыхание;
    • применение фена или тепловой пушки — наружный слой смеси высохнет быстрее внутреннего;
    • перепады температур — чем ниже падает температура, тем медленнее сохнет материал.

    Блок: 9/10 | Кол-во символов: 1282
    Источник: https://www.ivd.ru/stroitelstvo-i-remont/otdelocnye-materialy/gruntovka-sten-pod-oboi-kak-pravilno-ee-vybrat-i-ispolzovat-37231

    Condor — грунтовка бесцветная, конц. 1:3, 10л

    Грунтовка Condor — концентрат акриловой глубоко проникающей грунтовки, применяемый для внутренних и наружных работ. Концентрат разводится в соотношении: 1 к 3(грунт-концентрат/вода) для нормально впитывающих поверхностей (для нанесения на сухие строительные смеси), 1:2 для слабо впитывающих поверхностей (Древесина, гипсокартонные работы). Продукт не предназначен для нанесения в неразбавленном виде! Работы по нанесению грунтовки производятся при помощи кисти, валика или методом распыления. Окраску можно производить не менее чем через 12 часов после нанесения продукта.

    Грунтовка Condor предназначена для укрепления и грунтования минеральных (сухие строительные смеси, кирпич, гипсокартонные листы, бетон и др. ) и деревянных поверхностей.

    При нанесении, Condor грунтовка проникает в поверхность основания, закрепляя его и предотвращая осыпание. Помимо того увеличивается адгезионная способность основания (сцепляемость) и снижается его впитывающая способность , что приводит к снижению расхода лакокрасочного слоя или других наносимых материалов. Грунтовка Condor не содержит вредных органических растворителей.

    Упаковка: канистра, 5, 10 литров.

    Расход: около 30-100 г/кв.м.

    Блок: 10/15 | Кол-во символов: 1219
    Источник: https://maljarblog.ru/gruntovki/vidyi-gruntovok/bestsvetnaya-gruntovka-vidy-i-svojstva.html

    Как хранить раствор

    Срок годности зависит от состава смеси. Производитель указывает его на упаковке. При этом особо подчеркивается соблюдение условий хранения. Жидкость хранят в заводской таре в закрытом виде. Если канистру открывали и переливали в другую емкость — срок годности уменьшается. Не допускается хранение при минусовых температурах. Нужно беречь емкость от прямых солнечных лучей и обогревательных приборов. Концентрированный раствор, разведенный водой, лучше использовать в тот же день. Имеет смысл разводить не всю упаковку, а нужный объем.

    Обычно грунтовки хранятся дольше указанного заводом срока без потери качества. Непригодную к использованию можно определить визуально. В составе появляются комки, он расслаивается и на дно опускается плотный осадок. На поверхности появляются пятна или пленка. Сильный болотный запах тоже показатель негодности продукта.

    • Материал подготовила: Татьяна Молчанова

    Блок: 10/10 | Кол-во символов: 1423
    Источник: https://www.ivd.ru/stroitelstvo-i-remont/otdelocnye-materialy/gruntovka-sten-pod-oboi-kak-pravilno-ee-vybrat-i-ispolzovat-37231

    Jobi holzlasur grund (хольцлазур грунт) бесцветная грунтовка


    Прозрачная пропитка для максимальной защиты деревянных поверхностей от биологических поражений (плесени, грибков, синевы, гнили и насекомых-древоточцев) перед нанесением декоративно-защитной лазури JOBI HolzLasur Klassik и JOBI HolzLasur Gel. Для наружных работ. Глубоко проникает в древесину, обеспечивает повышенную адгезию и снижает расход при нанесении финишного покрытия.

    Пиленая древесина: 1 л на 6-8 кв. м- Строганая древесина: 1 л на 9-11 кв. м

    Основа для нанесения

    Гарантийный срок хранения

    Блок: 11/15 | Кол-во символов: 585
    Источник: https://maljarblog.ru/gruntovki/vidyi-gruntovok/bestsvetnaya-gruntovka-vidy-i-svojstva.html

    Грунтовка бесцветная ceresit ст 17 супер . сухие смеси и грунтовки. купить в киеве

    Подготовка основания

    Подготовка основания осуществляется согласно СНиП -87 и ДБН В.2.. Основание должно быть сухим и прочным, без видимых разрушений. Перед применением грунтовки основание очищается от пыли, наплывов, масляных пятен и других веществ, уменьшающих адгезию к основанию. Все неровности и непрочные участки основания следует удалить, а затем выровнять материалами групп CN, СТ, СХ в зависимости от состояния и назначения конструкции за 24 часа до начала работ. Основания с элементами биологической коррозии обработать специальным составом Ceresit CT 99 или удалить механическим путём.

    Выполнение работ

    Грунтовку Ceresit CT 17 супер необходимо наносить кистью, валиком или щёткой. В зависимости от состояния поверхности грунтовка может наноситься в один или два слоя. При обработке стяжки пола перед укладкой самовыравнивающихся покрытий грунтовка наносится в 2 слоя с интервалом 2 часа. При нанесении грунтовки в два слоя, для первого слоя может применяться грунтовка более низкой концентрации. Инструменты следует сразу же после применения промыть водой.


    Работы следует выполнять при температуре основания от +5°C до +35°C и и относительной влажности воздуха до 80%. Все вышеизложенные рекомендации эффективны при температуре +20°C и относительной влажности воздуха 60%. В других условиях время высыхания грунтовки может измениться.В случае попадания грунтовки в глаза, следует немедленно промыть их водой. При возникновении раздражения – обратиться за помощью к врачу.


    Кроме вышеизложенной информации о применении грунтовки при работе с ней следует руководствоваться действующими нормативными документами. Применение грунтовки не представляет трудности при условии соблюдения правил, изложенных в данном техническом описании. В случае применения грунтовки в других условиях необходимо самостоятельно провести испытания или обратиться за советом к производителю.

    Срок хранения

    В фирменной герметичной упаковке, в помещениях с постоянной температурой от +5°C до +35°С 12 месяцев от даты изготовления, указанной на упаковке. Предохранять от замораживания.

    Перед нанесением краски или лака на изделие из дерева, его нужно прогрунтовать. Для обработки деревянных поверхностей чаще всего используется бесцветная грунтовка, позволяющая сохранить текстуру древесины. О том, как подобрать подходящий состав, а также о разнообразии их видов и свойств, пойдет речь ниже.

    Блок: 12/15 | Кол-во символов: 2468
    Источник: https://maljarblog. ru/gruntovki/vidyi-gruntovok/bestsvetnaya-gruntovka-vidy-i-svojstva.html

    Кол-во блоков: 27 | Общее кол-во символов: 34259
    Количество использованных доноров: 6
    Информация по каждому донору:
    1. https://www.sehndvichpaneli.ru/dlya-chego-nuzhna-prozrachnaya-gruntovka-i-kak-ee-vybrat/: использовано 1 блоков из 4, кол-во символов 878 (3%)
    2. https://maljarblog.ru/gruntovki/vidyi-gruntovok/bestsvetnaya-gruntovka-vidy-i-svojstva.html: использовано 9 блоков из 15, кол-во символов 17168 (50%)
    3. http://shpatlevko.ru/page/gruntovka-prozrachnaja: использовано 2 блоков из 4, кол-во символов 2165 (6%)
    4. https://relend.ru/gruntovka-glubokogo-proniknoveniya-kakaya-luchshe-raschod-vidy-sten.html: использовано 3 блоков из 6, кол-во символов 6351 (19%)
    5. http://www.AllRemont.ru/showthread.php?t=15382: использовано 1 блоков из 2, кол-во символов 314 (1%)
    6. https://www.ivd.ru/stroitelstvo-i-remont/otdelocnye-materialy/gruntovka-sten-pod-oboi-kak-pravilno-ee-vybrat-i-ispolzovat-37231: использовано 9 блоков из 10, кол-во символов 7383 (22%)

    Виды грунтовок

    Мы всегда рады Вам! Звоните!

    В современном строительстве без грунтовок никуда. Правильный выбор типа грунтовочного материала является основополагающим фактором долговечности финишного покрытия отделочного материала в ремонте и строительстве. Многие задаются вопросом – для чего нужна грунтовка. Грунт применяется в качестве промежуточного материала перед нанесением финишных покрытий. Например  — вам нужно поклеить обои на бетонную стену, сначала наносим грунт, вам нужно покрасить метал, сначала наносим грунт, вам нужно покрасить стену, нанести декоративную штукатурку, что то зашпаклевать и т.д.


    Поговорим о наиболее распространенных грунтовочных материалах, применяемых в быту. Их можно условно разделить на две группы – водные и алкидные. Мы вкратце опишем их свойства и основные характеристики.

    Грунты на водной основе (применяются для гипсокартона, штукатурки, шпаклевки, кирпича, камня и т.д.)

    • Проникающий грунт.Самым распространенным материалом этой группы является грунтовка глубокого проникновения. Существует множество названий этой грунтовки у разных торговых марок производителей, среди которых, нередко встречается – «грунт универсальный», «грунт пропиточный», «грунт глубокого проникновения» и т.д. Основная характеристика этой грунтовки — «пропитать» поверхность , склеить пыль, побелку, укрепить верхний слой основания, забить поры (уменьшить впитываемость поверхности). В инструкции о применении проникающих грунтовок можно прочесть что они используются  для сильно впитывающих оснований таких как – гипсокартон,  шпаклевка, штукатурка, кирпич, бетон, старая водоэмульсионная краска и т.д. В общем, если поверхность так или иначе впитывает влагу – этот грунт просто необходим. После нанесения грунтовки к такой поверхности лучше приклеится краска, прослужит дольше и будет меньше расход, то же самое с другими покрытиями, которые вы будете наносить на загрунтованную поверхность – например декоративная штукатурка, обои и т.д. Отличить от других видов грунтовок его довольно легко. Это жидкость белого цвета, по внешнему виду и консистенции похожая на молоко.
    • Укрывной грунт.Укрывной грунт применяется не так часто, как пропиточный. Он используется исключительно в тех метах, где финишное отделочное покрытие может быть неравномерно нанесено. В местах предполагаемых «просветов» финишного материала. В этом случае укрывной, или его еще называют кроющим, колеруется в цвет финишного материала и используется вторым слоем после пропиточного. Такая грунтовка по внешнему виду и свойствам ничем не отличается от обычной краски и может применяться, как самостоятельное покрытие. У «добросовестных» фирм производителей кроющая способность такого грунта выше, чем обычная краска, т.к. наносится он обычно в один слой. Примером применения такого грунта может быть использование перед  поклейкой белых обоев на серый бетон, или при нанесении светлой декоративной тонкослойной штукатурки на темную поверхность.


    • Грунт с кварцем.Кварцевый грунт содержит в своем составе кварцевый наполнитель виде частиц песка. По свойствам и виду он похож на укрывной, с одним НО. После высыхания поверхность благодаря содержанию песка становится шероховатой, что облегчает нанесение толстослойных декоративных штукатурок, которые «тянутся» (наносятся) шпателем или кельмой. Упрощение процесса нанесения происходит за счет отсутствия проскальзывания штукатурки на шероховатой поверхности. Кварцевый грунт, как и укрывной может колероваться в цвет материала. Используется вторым слоем после проникающего, как альтернатива укрывному.  



    Алкидные грунтовки

    Алкидные грунты содержат алкидные смолы и разбавляются не водой, а уайстпиритом. Не нужно путать с растворителем. Меньше запаха, по сравнению с растворителем. Менее летучее вещество, по запаху скорее напоминает керосин.

    Алкидные грунты применяются для предварительной подготовки перед покраской дерева, металла, стекла,  пластика, керамики и т.д. В общем, любые не минеральные поверхности, в отличие от грунтов на водной основе.

    • Грунтовка по дереву.Достаточно жидкий, чаще всего прозрачный состав, глубоко пропитывает дерево, содержит антисептирующие добавки. Предотвращает появление плесени, синевы и грибка, а так же обеспечивает лучшее прилипание долгую службу финишного покрытия – краски, лака, антисептика на поверхности дерева. 





    • Грунт по металлу.Грунт по металлу содержит в своем составе противокоррозионные добавки, предотвращающие коррозию металла, и обеспечивают хорошее прилипание финишной краски, так же увеличивая ее срок службы.




    Специальные грунты.К специальным грунтам можно отнести грунты по пластику, стеклу, оцинковке и другим поверхностям. Химический состав грунта по пластику позволяет растворять верхний микрослой пластика, тем самым, как бы въедается в поверхность пластмассы, создавая на поверхности матовую шероховатую поверхность, к которой потом прилипает, практически любая краска.  Грунт по стеклу содержит в своем составе микрокальциды. Хорошо «цепляется» к стеклу, создает матовую шероховатую поверхность, которую потом можно покрасить любой краской.

    Оцинкованный металл довольно проблемная поверхность, т.к. поверхность цинка  постоянно окисляется. Если такую поверхность покрасить обычной краской, окислительная реакция очень быстро отторгнет краску. Грунтовка по оцинкованному металлу  тормозит процесс окисления цинка, тем самым удерживая долгое время на поверхности лакокрасочный слой.

    По всем возникшим вопросам звоните!


    +7(916)296-22-45 менеджер Сергей

    Белая грунтовка: применение для чистовой обработки


    7370 0 1

    Белый грунт позволяет скрыть мелкие дефекты и неровности потолков и стен.

    Хотите качественно сделать внутреннюю отделку стен в квартире? Чтобы грязно-серый бетон не просвечивал сквозь светлое декоративное покрытие, применяется белая грунтовка под обои. Я опишу несколько видов белого грунта, и расскажу, как его правильно использовать с различными отделочными и строительными материалами.

    Для чего нужна грунтовка

    Грунтовка представляет собой жидкую эмульсию, состоящую из синтетических полимерных смол, воды или органических разбавителей и комплексных вспомогательных добавок. Она предназначена для обработки поверхностей перед нанесением строительных выравнивающих смесей и лакокрасочных составов, а также перед наклеиванием рулонных и листовых отделочных материалов.

    Грунтовочный слой выполняет сразу несколько важных функций:

    1. Укрепление поверхности:
    • Укрывающая грунтовка глубоко проникает в пористые поверхности, а после испарения разбавителя прочно связывает между собой твердые частицы материала;
    • Это позволяет укрепить поверхностный слой и уменьшить образование пыли на минеральных строительных материалах (бетон, кирпич, штукатурка, шпаклевка).

    Поверхностный слой грунтовки задерживает воду, но пропускает водяной пар.

    1. Гидроизолирующие свойства:
    • Полимерные смолы заполняют пространство между твердыми частицами, за счет чего материал не впитывает воду, но свободно пропускает воздух и водяные пары;
    • Это приводит к увеличению морозостойкости и долговечности строительных материалов, поскольку при замерзании вода расширяется и образует разрывы и микротрещины.
    1. Уменьшение расхода ЛКМ и строительных смесей:
    • Необработанные поверхности сильно впитывают воду и органические растворители при нанесении строительных смесей, клея и лакокрасочных составов;
    • После закупоривания открытых пор, разбавители не впитываются в толщу материалов, что предохраняет от преждевременного застывания клея, краски и прочих составов.

    Для обработки потолков и стен во влажных помещениях обязательно использовать антисептическую грунтовку.

    1. Антисептические свойства:
    • Белая пигментированная грунтовка содержит противомикробные вещества и антисептические препараты;
    • Это помогает защитить материал от гниения, а на обработанной поверхности не образуется плесень.
    1. Улучшение адгезии:
    • После испарения разбавителей на поверхности остается тонкая пористая пленка из полимерных смол;
    • Она является хорошей основой для нанесения клея, шпаклевки и краски, поскольку обладает высокой адгезией к большинству отделочных материалов.

    К поклейке обоев можно приступать не ранее, чем через сутки после нанесения грунта.

    1. Выравнивание цвета:
    • Светлые обои на бетонной, деревянной или кирпичной стене могут приобретать грязно-серый или грязно-рыжий оттенок. Это же касается и покраски светлыми интерьерными красками;
    • Чтобы исключить проявление темных пятен, для выравнивания цвета стен применяется грунтовка белого цвета;
    • Белый акриловый грунт не искажает оттенки других цветов, поэтому подходит не только для поклейки светлых обоев, но и для нанесения темных, пастельных или насыщенных ярких цветных покрытий.

    Перед каждым этапом отделочных работ на поверхность нужно наносить слой грунтовки.

    Для нанесения грунта удобнее всего использовать малярный валик на длинной ручке или пневматический пульверизатор. Если вы будете использовать кисточку, на стене могут остаться непрокрашенные места, подтеки и разводы.

    Как выбрать грунтовку

    В зависимости от своего назначения и составных компонентов, строительные грунтовки делятся на несколько видов. Каждый из них можно использовать только для определенного вида работ.

    На схеме можно увидеть характерные свойства грунтов для строительных и отделочных работ.

    В таблице показана иллюстрированная инструкция по выбору и самостоятельному изготовлению грунтовки:

    Иллюстрация Предназначение грунтовки
    Грунтовка для стен и потолков:
    1. Для обработки минеральных поверхностей применяется пигментированная грунтовка на водной основе, которая равномерно окрашивает стены в белый цвет;
    2. Если вы делаете ремонт в туалете или ванной комнате, под плитку нужно использовать латексную грунтовку, которая обладает хорошими гидроизолирующими свойствами;
    3. Для покраски или поклейки обоев на гипсокартонные стены применяется быстросохнущая белая акриловая грунтовка.
    Грунт по металлу:
    1. Чистый металл имеет гладкую поверхность, поэтому краска на нее ложится не очень хорошо;
    2. Чтобы улучшить адгезию ЛКМ с металлом применяется грунтовка на основе алкидных смол;
    3. Для обработки ржавого металла применяется грунт с добавлением преобразователя ржавчины или ортофосфорной кислоты;
    4. Чтобы обеспечить длительную антикоррозионную защиту, в грунтовку добавляется порошок железного или свинцового сурика.

    Я рекомендую использовать белую грунтовку OTEX (как на фото) от финской компании Tikkurila. Она хорошо подходит для дерева и для металла. Ее цена немножко выше, чем стоимость отечественных налогов, зато она отличается высокой долговечностью и хорошей укрывающей способностью.

    Грунтовка для дерева и древесноволокнистых материалов.

    Для обработки древесины применяется несколько видов грунтовок:

    1. Алкидный грунт — под масляные краски и эмали на алкидной основе;
    2. Акриловая грунтовка — под покраску акриловыми, силиконовыми и силикатными красками;
    3. Полиуретановый и латексный грунт — обработка древесины для использования под открытым небом.

    Любая грунтовка для дерева должна содержать антисептические компоненты.

    Самодельный белый грунт под обои.

    Если у вас нет под рукой белой грунтовки, я расскажу, как ее сделать своими руками с использованием доступных компонентов:

    1. Интерьерную акриловую краску белого цвета развести водой до консистенции густого сиропа;
    2. В отдельной посуде приготовить клей для обоев, как указано в заводской инструкции;
    3. Смешать готовый клей и разведенную краску в пропорции 1:2;
    4. Для грунтования бетонных стен в раствор добавить 1/10 объемную часть молотого строительного мела;
    5. Смесь нужно тщательно перемешать строительным миксером, потом оставить на полчаса для удаления пузырьков воздуха, а затем еще раз медленно перемешать.


    Теперь вы понимаете, что перед нанесением отделочных покрытий стены обязательно нужно грунтовать, а для поклейки обоев и окрашивания стен должна использоваться только белая грунтовка. Все предложения оставляйте мне в комментариях, и обязательно просмотрите видео в этой статье.

    Понравилась статья? Подписывайтесь на наш канал Яндекс.Дзен 14 июня 2017г.

    Если вы хотите выразить благодарность, добавить уточнение или возражение, что-то спросить у автора — добавьте комментарий или скажите спасибо!

    проникающая грунтовка для стен и потолков, универсальные составы для внутренних работ

    Задумав отделку стен, потолка или пола, хочется выполнить работу максимально практично, даже если рабочая поверхность выглядит старо и пористо. С этим без труда справляются мастера, так как секрет успеха сосредоточен в использовании специального средства для обработки поверхности. Разберемся вместе в назначении акриловой грунтовки глубокого проникновения и технологии ее нанесения.


    Акриловая грунтовка глубокого проникновения представляет собой специальный материал для обработки поверхности перед выполнением отделочных работ, в готовом виде по консистенции напоминающий молоко.

    Цвет может быть разным: чаще он прозрачный, иногда белый, розоватый, светло-серый. Данная грунтовка является одной из разновидностей акрилового грунта. Она не является универсальным средством, поэтому покупка материала должна основываться строго на назначении препарата.

    Сегодня без такого грунта не обходится ни один тип отделочных работ. Материал немного липкий, если сразу не смыть с рук, удаляется с трудом.

    Продается преимущественно в банках и канистрах. Объем зависит от стандартов производителя. Чаще такие составы выпускают объемом 10 л.

    При попадании в глаза нужно срочно промыть их обычной водой. Кожу рук не разъедает, в зависимости от основы может быть экологичным без запаха или с небольшим специфическим ароматом, который не препятствует рабочему процессу.

    Данный материал продается в виде сухой смеси и готового к обработке раствора. В первом случае это порошок, который необходимо разводить водой согласно инструкции.

    Воду используют прохладную: от горячей пострадают эксплуатационные характеристики строительного продукта. Это удобно, так как такого материала обычно хватает для обработки пола, стен и потолка просторной комнаты.

    Остатки можно хранить в течение 12 месяцев, плотно закрыв крышку и убрав сырье в темное место. Хранить его на морозе недопустимо. Срок годности акриловой грунтовки глубокого проникновения составляет 2 года с момента выпуска. Мастера не рекомендуют пользоваться ей после того, как закончится срок годности.

    Преимущества и недостатки

    Акриловый грунт глубокого проникновения имеет массу достоинств. Такое средство укрепляет основание, делая его структуру достаточно прочной. Использовать этот состав можно для наружных и внутренних работ. Он подходит для самых ненадежных оснований, которые внешне не вселяют уверенность в успехи облицовки. У данной грунтовки высокая вязкость. Ее удобством является водорастворимость.

    Использование акрилового грунта позволяет сэкономить на количестве клеевого состава либо краски: обработанная поверхность больше не впитывает жидкость в большом объеме, поэтому быстро не высыхает и позволяет провести отделочные работы аккуратно, без спешки.

    После обработки данной грунтовкой темных поверхностей краска ложится равномерно без непрокрашенных участков, полос и иных дефектов. При этом глянец поверхности более выражен. Касаемо остальных компонентов отделки можно отметить: нанесение плиточного и обойного клея после применения грунта становится более равномерным, что упрощает отделку.

    Латексной грунтовке присуща паропроницаемость. Несмотря на то, что она проникает вглубь основания и укрепляет даже пористые поверхности, на ней не будут появляться микроорганизмы и плесень. При этом сама грунтовка после нанесения не тормозит облицовочные работы: сохнет она быстро даже при обычной комнатной температуре. Время высыхания может быть разным, так как оно зависит от типа используемого растворителя (быстрого, медленного, классического).

    Недостатком акриловой грунтовки является некоторое неудобство разведения концентрата, что нравится не всем. В основном на это сетуют новички, которые боятся в точности воссоздать нужную консистенцию, что приводит к увеличению расхода грунта.

    Несмотря на тот факт, что грунтовкой может обрабатывать разный тип поверхности, не каждый состав подходит для обработки темных металлов. Поэтому использование данного средства при облицовке допустимо только в случае, если нужный тип поверхности есть в списке, отмечен на упаковке.

    Для чего нужна?

    Акриловая (или латексная) грунтовка подходит для поверхностей разного состава. Действие материала основано на придании обрабатываемой плоскости высокого сцепления с последующим нанесенным материалом. Она нужна для того, чтобы отделка держалась на поверхности максимально долго.

    Данный грунт не просто обрабатывает верхний слой основания под отделку: он проникает на глубину от 5 до 10 см вглубь плоскости, на которую нанесен.

    Действие основано на проникающей способности, которая позволяет укрепить стены, выполненные застройщиком с нарушением технологии. Это чаще бетонные стены или штукатурка, в которых песка заметно больше нормы. Такие поверхности осыпаются, что затрудняет процесс отделки и может сказаться на конечном результате. Действие акрилового грунта позволяет проникнуть глубоко в трещины и проблемные места поверхностей.

    Материал связывает не только микротрещины: он соединяет пыль и заставляет все зоны поверхности с риском плохой прочности максимально удерживать облицовочный материал. При этом вовсе не важно, обои это, керамическая, потолочная плитка или наливной пол. Интересной особенностью является образование на поверхности в процессе застывания шероховатой сетки, которая выравнивает основание, выполняя его подготовку к последующей обработке.

    Акриловая грунтовка подходит для обработки цементно-бетонных стяжек, ею можно обрабатывать деревянные, штукатуреные типы поверхностей, известняк. Она склеит мельчайшие частицы основания, будет способствовать предотвращению образования синевы и гниения.

    Этот грунт является защитой от сырости. Использовать его можно при подготовке поверхности под паркет, эмали, мраморную крошку, структурную штукатурку. Она везде воздаст монолитную ровную основу.

    Технология нанесения

    Нанесение грунта на поверхность легче, чем кажется на первый взгляд.

    При работе понадобятся:

    • поролоновый валик;
    • плоская кисть;
    • маленькая плоская кисть;
    • перчатки;
    • плоская емкость под грунтовку.

    В случае с сухим концентратом к данному набору стоит добавить тару для разведения материала, который разводят строго в пропорциях, указанных производителем (обычно 1: 4).

    Размешивание осуществляют до тех пор, пока состав не станет однородным. При этом может понадобиться маска, чтобы сухой состав не попал в легкие.

    После приготовления необходимого инвентаря и самой грунтовки приступают к обработке поверхностей. Грунт наливают в плоскую емкость, примерно на 1/3 закрывая по объему размещенный в ней валик. Больше наливать не стоит: раствор будет стекать с валика в большом количестве, что неудобно при обработке поверхностей стен или потолков. Валик удобен тем, что с его помощью время, потраченное на обработку поверхности, сокращается в два раза.

    Заливать стены нет необходимости: у грунтовки и так высокая проникающая способность. Однако и экономить тоже не следует: главное, чтобы при прокатке поверхности не было брызг. Движения не должны быть резкими: это особенно актуально, если ремонт в комнате частичный. Если грунт попадет, скажем, на обои, на них могут остаться пятна.

    Раствор набирают на валик и прокатывают им поверхности под дальнейшую облицовку. Поскольку в любой работе не обойтись без обработки углов стыков и неудобных мест, рабочий инструмент меняют на кисть нужного размера. Валик не справляется с аккуратной обработкой углов: обычно в таком случае не избежать потеков по стенам.

    Кисть позволит избежать ненужного расхода, сделает обработку более аккуратной.

    Когда все плоскости обработаны, нужно сразу удалить остатки грунтовки с инструментов и тары. Если оставить это на потом, поролон и щетина кисти станут дубовыми. После их застывания кисти и шубку из поролона придется выкинуть. В процессе работы материал стоит подливать в емкость понемногу: вылить остатки обратно в общую канистру не получится (на них будут мельчайшие частицы пыли либо микрофрагменты цементной стяжки).

    Грунтуют поверхность дважды. При этом повторное применение грунта возможно только после того, как высохнет первый слой.

    Что учесть?

    Чтобы проведение отделочных работ не осложнилось из-за выбора неправильной грунтовки или неправильного ее нанесения, стоит учесть несколько рекомендаций.

    Специалисты рекомендуют при покупке обращать внимание на срок годности. Если до его конца осталось менее месяца, а продукт заведомо может остаться, либо берут его впритык с докупкой, либо выбирают материал другой марки.

    Предпочтительней пользоваться грунтом проверенной компании с хорошей репутацией: дешевые разновидности не отличаются хорошей вязкостью, они не смогут создать крепкую кристаллическую сетку и выровнять основание на должном уровне.

    Чтобы сцепление было максимальным, перед нанесением самой грунтовки поверхность нужно избавить от пыли, загрязнений и особенно жировых пятен, препятствующих качественной отделке. Распределяясь посредством валика по поверхности облицовочного полотна, пыль, песчинки будут препятствовать дальнейшей поклейке обоев, являясь причиной мелких пузырей под обоями.

    Производить облицовку можно после полного высыхания второго слоя грунта. Это определяется тем, что при касании к поверхности она не липнет. Грунтуют стены перед обработкой. Если ремонт не планируется еще в течение месяца, нет смыла наносить грунтовку заранее.

    Нельзя обрабатывать пол грунтовкой, если он не подготовлен и имеются существенные трещины: это приведет к протеканию состава. Большие проблемы он не исправит, для этого нужно воспользоваться цементным составом.

    Инструкцию по нанесению грунтовки глубокого проникновения смотрите ниже.

    Primer-BLAST: инструмент для разработки целевых праймеров для полимеразной цепной реакции | BMC Bioinformatics

    Пользовательский интерфейс

    Интерфейс состоит из нескольких разделов, где пользователи могут вводить шаблон ПЦР и / или уже существующие праймеры, а также другие настраиваемые пользователем параметры (рис. 1).

    Рисунок 1

    Веб-интерфейс Primer-BLAST.

    Пользователи могут создавать новые пары праймеров, вводя только матрицу ДНК, или они могут создавать один праймер, вводя матрицу плюс другой уже существующий праймер.Primer-BLAST может проверять специфичность уже существующих праймеров с шаблоном или без него. Матрица ПЦР может представлять собой необработанную последовательность ДНК в формате FASTA или регистрацию NCBI. Если возможно, рекомендуется использовать регистр RefSeq, поскольку он несет больше информации о последовательности [15], что позволяет Primer-BLAST лучше идентифицировать матрицу и, таким образом, лучше проверять специфичность праймера. Primer-BLAST также выполняет быструю проверку любой исходной входной последовательности, чтобы определить, является ли она точным совпадением с последовательностью RefSeq, и в этом случае Primer-BLAST будет использовать доступ RefSeq в качестве шаблона.Длина шаблона ограничена 50 000 базами. Для более длинных шаблонов следует использовать диапазон праймера (верхний правый угол рисунка 1), чтобы ограничить длину.

    Primer-BLAST также предлагает возможность конструирования праймеров на основе структуры экзона / интрона, чтобы амплификация ПЦР могла быть лучше нацелена на мРНК. Пользователи могут указать, должен ли праймер охватывать соединение экзон / экзон с регулируемым количеством оснований на каждой стороне соединения и должна ли пара праймеров охватывать интрон вместе с возможностью указания размера интрона.Поскольку этот параметр зависит от точной аннотации границ экзона / экзона, требуется присоединение RefSeq (в качестве шаблона ПЦР), поскольку RefSeq представляет собой категорию лучше всего курируемых последовательностей в NCBI.

    Доступно несколько вариантов баз данных для проверки специфичности с широким охватом организмов. Они включают базу данных мРНК RefSeq и базу данных генома RefSeq, которые по состоянию на 18 ноября 2011 г. содержат 226 и 7 546 организмов соответственно. Эти базы данных не являются избыточными, поскольку они не содержат одни и те же участки последовательности более одного раза, что позволяет лучше проверять специфичность.Они являются предпочтительными базами данных для разработки новых специфичных для мишени праймеров. Традиционная база данных nr, содержащая повторяющиеся записи, также доступна и в основном рекомендуется для организмов, которые не охвачены другими базами данных, или для записей последовательностей, не охваченных базами данных RefSeq.

    Primer-BLAST предлагает гибкие варианты строгости специфичности. Пользователи могут указать количество несовпадений, которые пара праймеров должна иметь с непреднамеренными мишенями, а также 3’-концевую область, где эти несовпадения должны присутствовать.Кроме того, пользователи могут указать порог рассогласования, выше которого любые цели должны игнорироваться (т. Е. Отфильтровывать цели, имеющие слишком много несовпадений, чтобы беспокоиться о неспецифическом усилении). Настройки специфичности по умолчанию таковы, что по крайней мере один праймер (для данной пары праймеров) должен иметь два или более несовпадения с непреднамеренными целями в последних пяти основаниях на 3 ‘конце, и что любые цели с шестью или более несовпадениями по крайней мере с одним праймер (для данной пары праймеров) следует игнорировать.

    Не всегда возможно сгенерировать праймеры, специфичные для мРНК конкретного варианта сплайсинга, когда различие в экзонах недостаточно, чтобы отличить один от остальных.Таким образом, Primer-BLAST предлагает вариант обработки вариантов сплайсинга, который позволяет амплифицировать другие варианты того же гена.

    Другие параметры, включая параметры чувствительности поиска BLAST, исключения SNP, свойств праймера и т. Д., Можно найти в разделе «Дополнительные параметры».

    Представление результатов

    Страница результатов сообщает о специфичности сгенерированных праймеров, графическом обзоре пар праймеров по отношению к матрице ПЦР и некоторых характеристиках, таких как экзоны, а также подробную информацию о каждой паре праймеров.Он покажет только специфичные для мишени праймеры, если они будут обнаружены; в противном случае он сообщит обо всех праймерах. Во всех случаях будут перечислены фактические цели вместе с подробным выравниванием праймеров и мишеней.

    В качестве примера для иллюстрации функциональности Primer-BLAST мы конструируем праймеры с использованием мРНК варианта 5 транскрипта человеческого цинкового пальца 419 (ZNF419) (номер доступа в Genbank NM_001098494). Как показано на рисунке 2, согласно отчету NCBI Gene, существует семь вариантов транскрипта для гена ZNF419.При поиске использовались значения по умолчанию, которые требуют, чтобы по крайней мере один праймер (для данной пары праймеров) имел два или более несовпадения с непреднамеренными целями в последних пяти основаниях на 3 ’конце. Проверку специфичности проводили по базе данных мРНК NCBI RefSeq с организмом, ограниченным человеческим организмом, поскольку целью было найти пары праймеров, которые специфичны для этого транскрипта только среди человеческого транскриптома. Чтобы избежать возможной амплификации геномной ДНК, выбран вариант «Праймер должен охватывать соединение экзон-экзон».Как показано на рисунке 3, Primer-BLAST успешно вернул пять специфических пар праймеров, и показано детальное сопоставление между мишенями и праймерами. В процессе поиска Primer-BLAST проверил в общей сложности 355744 совпадения BLAST (см. Легенду на Рисунке 3), которые представляют не только варианты транскриптов этого гена, но также большое количество транскриптов из других генов, которые показывают совпадения в различной степени с кандидатом. грунтовки. Это подчеркивает проблему, если такая же тщательная проверка специфичности праймера должна выполняться вручную.Среднее время поиска для создания новых праймеров с параметрами по умолчанию с использованием шаблона мРНК человека средней длины (2800-3000 оснований) составляет 2,6 минуты.

    Рисунок 2

    Схематическое выравнивание вариантов транскриптов мРНК из гена ZNF419. Числа указывают конечные положения экзонов для варианта 5. Красные линии указывают области праймеров, выбранные с помощью Primer-BLAST. Обратите внимание, что несколько транскриптов отличаются на 3 нуклеотида из-за использования немного разных сайтов сплайсинга, даже если они имеют одни и те же экзоны (т.е., вариант 2 в.с. вариант 1, вариант 7 в.с. вариант 6 и вариант 4 против. вариант 3). График адаптирован из отчета NCBI по генам (http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=Retrieve&dopt=full_report&list_uids=79744. Данные по состоянию на 11.02.2011).

    Рисунок 3

    Пример результатов разработки специфичных для мишени праймеров. Обратите внимание, что хотя было возвращено пять пар праймеров (как показано в графическом обзоре), из-за ограничения места на рисунке показаны детали только для первой пары праймеров.Ссылка «Сводка поиска» при нажатии показывает используемые параметры поиска, а также общее количество совпадений BLAST, сгенерированных в процессе поиска (355 744 совпадений для текущего поиска). Цифры в выравнивании указывают начальное и конечное положения праймера и мишени. Точка (.) Указывает идентичность нуклеотидов с последовательностью праймера. Обыск производился 02.11.2011.

    Исследование выравнивания варианта транскрипта 5 с другими вариантами показывает, что наличие экзона 2 и отсутствие экзона 4 в сочетании являются единственными признаками, которые отличают его от остальных (рис. 2).Неудивительно, что часть или все прямые праймеры, выбранные Primer-BLAST, расположены в экзоне 2, а все обратные праймеры находятся на стыках между экзоном 3 и 5 (поскольку экзон 4 отсутствует).

    Primer-BLAST также можно использовать для проверки специфичности уже существующих праймеров. В качестве примера мы получили праймеры для той же матрицы ПЦР, что и выше (т. Е. МРНК варианта 5 транскрипта ZNF419) из PrimerBank, который хранит множество предварительно рассчитанных ген-специфических праймеров для обнаружения мРНК [16]. Опять же, были использованы параметры специфичности по умолчанию, и результат представлен на рисунке 4.В результате поиска было получено 11 236 совпадений BLAST из базы данных мРНК RefSeq с организмом, ограниченным человеческим организмом, что еще раз демонстрирует сложность ручного анализа результатов BLAST даже для одной пары праймеров. Эта пара праймеров действительно демонстрирует идеальные совпадения с вариантом 5 транскрипта гена ZNF419, а также с другими вариантами транскрипта того же гена и может генерировать ампликон из 444 оснований. Это согласуется с критериями отбора PrimerBank, согласно которым праймеры специфичны только на уровне гена, а не на уровне транскрипта.Интересно, что обнаруживаются и некоторые другие потенциальные ампликоны. Один из них представляет собой дополнительный ампликон из 780 оснований, присутствующий в предполагаемом транскрипте ZNF419. Другой — это ампликон из 444 оснований из другого гена (т. Е. Белка 773 цинкового пальца человека, номер доступа в Genbank NM_198542.1). Однако существует до 5 несовпадений по крайней мере между одним из праймеров и мишенями, что, вероятно, достаточно для предотвращения интерференции амплификации или неспецифической амплификации. Тем не менее, пользователи могут внимательно изучить этот результат и сделать выводы, основываясь на собственном экспериментальном опыте.

    Рисунок 4

    Проверка специфичности существующих праймеров. Этот поиск был выполнен путем ввода прямого и обратного праймеров без ввода какого-либо шаблона. Праймеры (прямой праймер: GTAGGACTGCTCAGTTCAAACAT, обратный праймер: ACAGTTACTACACCCGTAAGGC) были получены из PrimerBank (http://pga.mgh.harvard.edu/primerbank/) 11.02.2011 с использованием варианта 5 транскрипта ZNF419 (доступ в GenBank NM_001098494). Хотя результаты показали, что все 7 вариантов транскриптов гена ZNF419 имеют одинаковые ампликоны, на этом рисунке показаны детали только для вариантов 1 и 5 из-за ограниченного пространства.Текущий поиск сгенерировал 11 236 совпадений BLAST (выполнено 11.02.2011).

    Сравнение с другими инструментами для разработки праймеров

    Primer-BLAST предлагает ряд функций, которые недоступны в других программных инструментах. В таблице 1 дается краткое изложение этих характеристик, многие из которых важны для различных требований к конструкции праймеров и позволяют пользователям изучить детали специфичности праймера. Например, Primer-BLAST — единственный инструмент, который предлагает возможность указывать количество несовпадений, которые должна иметь конкретная пара праймеров с непреднамеренными целями, и настраиваемая 3 ’концевая область, где должно присутствовать определенное количество несовпадений.Этот параметр важен для удовлетворения различных требований пользователей к строгости специфичности праймера, поскольку специфичность праймера обычно оценивается по количеству несоответствий, которые он имеет с непреднамеренными целями (большее количество несоответствий дает большую специфичность), и местоположением таких несоответствий (несоответствия). ближе к 3 ‘концу предлагаю больше конкретики). Primer-BLAST — единственная программа из трех, которая будет размещать праймеры на разных экзонах (т. Е. Для охвата интрона), чтобы избежать амплификации геномной ДНК, а также единственная программа, позволяющая настраивать количество совпадений нуклеотидов с обеих сторон соединение экзон / экзон.Кроме того, Primer-BLAST представляет подробные сопоставления между найденными праймерами и мишенями.

    Таблица 1 Сравнение выбранных функций среди различных инструментов для разработки праймеров

    Еще одним преимуществом Primer-BLAST является высокая чувствительность обнаружения. Как показано выше, Primer-BLAST по умолчанию способен обнаруживать потенциальные мишени амплификации, которые имеют до 5 несовпадений с праймером. Primer-Blast достигает этого результата за счет использования высокочувствительных параметров BLAST, а также дополнительного алгоритма глобального выравнивания NW для обеспечения полного выравнивания между праймером и его мишенью.Однако есть одно предостережение: алгоритм BLAST [6] требует минимального количества совпадений нуклеотидов (размера слова) между запросом и целью, и любые инструменты, использующие BLAST в качестве алгоритма поиска, подпадают под это ограничение. Следовательно, Primer-BLAST (с параметрами по умолчанию) пропустит любые цели, у которых есть 6 или меньше последовательных совпадений с праймером (поскольку Primer-BLAST использует размер слова 7 по умолчанию). Например, если цель имеет несовпадения с праймером из 20 оснований в положениях 7 и 14 (при условии, что конец 5 ‘находится в позиции один), цель будет пропущена Primer-BLAST (с параметрами по умолчанию), даже если у нее только 2 несоответствия.Предполагая случайное распределение местоположений несовпадений, можно вычислить количество возможных расположений из 18 совпадений и 2 несовпадений. Существует 20 * 19 различных способов разместить 2 несоответствия среди 18 совпадений, но только 2 из них приводят к размеру слова меньше 7, поэтому вероятность пропуска цели с 2 несовпадениями с праймером из 20 оснований равна 2 / (20 * 19) или около 0,5%.

    Далее мы сравним чувствительность обнаружения цели между Primer-BLAST и другими инструментами для разработки праймеров, такими как QuantPrime и PRIMEGENS.В идеале сравнение чувствительности обнаружения должно заключаться в непосредственном тестировании модулей проверки специфичности во всех инструментах с использованием праймеров, созданных третьей стороной (например, праймеров, созданных с помощью Primer3). К сожалению, этот вариант недоступен, поскольку Primer-BLAST — единственный инструмент, который предлагает прямую проверку специфичности (то есть проверку специфичности уже существующих праймеров). В качестве альтернативы мы использовали QuantPrime и PRIMEGENS для создания специфичных для мишени праймеров, а затем использовали Primer-BLAST для исследования этих праймеров на предмет потенциальных мишеней.Если Primer-BLAST не находит других целей, кроме предполагаемой (т.е. самой входной матрицы мРНК), то можно сделать вывод, что QuantPrime и PRIMEGENS по крайней мере так же чувствительны, как Primer-BLAST. С другой стороны, наличие непреднамеренных целей, обнаруженных с помощью Primer-BLAST, может указывать на то, что эти инструменты не так чувствительны, как Primer-BLAST, в чувствительности обнаружения целей (поскольку эти инструменты уже исследовали такие цели, но не смогли избежать их во время их выбора. процессы для специфичных для мишени праймеров).

    Тестовые шаблоны выбираются случайным образом из базы данных мРНК NCBI Refseq, и они включают 52 человеческие последовательности для тестирования QuantPrime и 24 последовательности Arabidopsis thaliana для тестирования PRIMEGENS (поскольку PRIMEGENS не поддерживает человеческие последовательности). Как показано в таблице 2, QuantPrime или PRIMEGENS сгенерировали пары праймеров для большинства тестовых случаев, которые они сочли специфичными для входных шаблонов. Однако Primer-BLAST выявил, что многие из них (13,4% пар праймеров из QuantPrime и 43,3% пар праймеров из PRIMEGENS) имеют потенциальные непреднамеренные мишени, которые показывают от одного до пяти несовпадений нуклеотидов.В результате большая часть тестовых случаев имеет по крайней мере одну пару праймеров, которая имеет потенциально непреднамеренные цели (31,5% для QuantPrime и 93,3% для PRIMEGENS). Некоторые мишени имеют только одно или два несоответствия праймерам, полученным из QuantPrime (18,5%), хотя эта часть намного меньше для PRIMEGENS (3,4%).

    Таблица 2 Сводка потенциальных непреднамеренных целей для пар праймеров, о которых сообщили QuantPrime и PRIMEGENES a

    На рисунке 5 показаны детали для 5 потенциальных непреднамеренных целей.Например, QuantPrime генерирует две пары праймеров (пример 1 и 2), которые разработаны, чтобы быть специфичными для доступа Genbank NM_182690.2 и NM_001039567.2, соответственно (рисунок 5). Однако Primer-BLAST показывает, что эти две пары имеют потенциальные непреднамеренные мишени, NM_005227.2 и NM_001008.3, соответственно, которые имеют только одно нуклеотидное несоответствие прямому или обратному праймерам. Пара праймеров, созданная PRIMEGENS (пример 4), также показывает потенциальную непреднамеренную мишень только с одним несоответствием.Как было рассмотрено ранее, несоответствие одного нуклеотида (даже на 3 ’конце) не оказывает значительного влияния на амплификацию мишени, и поэтому эти пары праймеров вряд ли будут специфичными для предполагаемых мишеней. Неспособность обнаружить единственное несоответствие оснований (нуклеотидное основание G в примере 1) или около 3 ’конца (нуклеотидное основание C в примере 2) показывает недостаток использования только алгоритма локального выравнивания. Локальное выравнивание пытается максимизировать результат, который оно возвращает, поэтому оно не будет включать несоответствия в конце или (возможно) ближе к концу выравнивания, поскольку они уменьшили бы общую оценку [6].Другие случаи непреднамеренных мишеней включают 2 несовпадения (пример 3) или 5 несовпадений (пример 5) с одним из праймеров.

    Рисунок 5

    Примеры потенциальных непреднамеренных мишеней для пар праймеров, созданных с помощью QuantPrime и PRIMEGENS. Примеры мишеней извлекаются из результатов проверки специфичности Primer-BLAST для пар праймеров, созданных с помощью QuantPrime или PRIMEGENS (всего было идентифицировано 162 и 116 потенциальных непреднамеренных мишеней для QuantPrime и PRIMEGENS, соответственно.См. Подробности в таблице 2). Примеры праймеров соответствуют тем, которые подчеркнуты в дополнительных файлах 1 и 2.

    Таким образом, мы заключаем, что Primer-BLAST способен обнаруживать потенциальные непреднамеренные цели, которые не попадают в поле зрения QuantPrime или PRIMERGENS во время процесса скрининга специфичности.

    Какую цветную грунтовку использовать

    Какую цветную грунтовку использовать | Шервин-Вильямс Диалог сообщений Показать сообщение об обновлении

    «Но этот цвет совсем не похож на тот, что на микросхеме!» Большинство подрядчиков по покраске слышали такое от заказчиков в то или иное время.Это неприятная дилемма, которая особенно характерна для прозрачных, глубоких или ярких цветов. Но вы можете легко решить эту проблему, используя испытанную цветовую палитру вместе с правильным базовым покрытием, когда цвет важен для вашего клиента. (А когда нет?)

    Грунтовка с белым или серым оттенком или цвет верхнего покрытия?

    Система Sherwin-Williams COLOR® — это палитра из более чем 1000 оттенков, созданная при участии подрядчиков, архитекторов, дизайнеров и проектировщиков.Он также был разработан с использованием передовых технологий для поддержки более точной цветопередачи.

    Обычной практикой является использование белой грунтовки или грунтовки, тонированной краской. Тем не менее, около 20 процентов цветов в системе Sherwin-Williams COLOR® максимизируются при нанесении на серое базовое покрытие. Эта идея или технология — это система Color Prime Sherwin-Williams. Использование серого базового покрытия или грунтовки для этих цветов дает несколько преимуществ, в том числе лучшую ретушь, превосходную шкуру и более однородный цвет.Маляры также экономят время и деньги, поскольку могут добиться точного соответствия цвета за меньшее количество слоев. Лучше всего то, что система проста в использовании, потому что компания Sherwin-Williams устранила догадки.

    Как это работает

    Эксклюзивная система Color Prime от Sherwin-Williams представляет собой непрерывный спектр оттенков серого, который начинается со светло-серого (P1) и постепенно углубляется до P6 или самого темного серого. Эта технология основана на том, как цветной пигмент рассеивает и поглощает свет.

    Грунтовка, окрашенная в рекомендуемый оттенок серого, создает идеальный баланс поглощения и рассеивания света для достижения правильного цвета за меньшее количество слоев. Работая внутри цветового пространства цвета верхнего покрытия, правильный оттенок базового покрытия позволяет ему более полно и быстрее развить свой истинный цвет.

    Итог: вы быстрее и легче добьетесь истинных цветов. Кроме того, вы уменьшите вероятность услышать, как покупатель будет жаловаться на то, что цвет на стене не соответствует цвету чипа.

    Просто следуйте указаниям

    Как узнать, когда использовать базовое покрытие серого оттенка Color Prime? Есть два простых способа: спросить представителя Sherwin-Williams или посмотреть на обратной стороне цветного чипа верхнего покрытия. Если вы видите код от P1 до P6, обязательно используйте грунтовку определенного оттенка серого. Юмористический зеленый (SW 6918), например, требует серого оттенка P3, в то время как вы должны использовать серый оттенок P2 с Nervy Hue (SW 6917). Это так просто.

    Результаты реального мира

    Альдо Марини, владелец компании Interior Solutions в Кливленде, штат Огайо, говорит, что система серой грунтовки Sherwin-Williams экономит время и деньги на его новых жилых проектах.

    «Я работаю со многими декораторами и строителями высокого класса, которые задают более глубокие цвета», — говорит он. «Раньше нам часто требовалось три слоя, чтобы получить правильный цвет. Мой торговый представитель Sherwin-Williams знал, что это беспокоит меня, и познакомил меня с системой Color Prime около двух лет назад.«

    Он обнаружил, что использование системы грунтовки серого оттенка позволяет ему получить такие же качественные результаты всего за два слоя. Нет никаких догадок, так как он только что приказал своему магазину Sherwin-Williams добавить серый оттенок, указанный на цветовом чипе Sherwin-Williams, к своему любимому праймеру PrepRite. Он также будет использовать серый оттенок Color-Prime Interior Primer при работе с финишным покрытием ColorAccents.

    «Раньше я избегал использования ColorAccents на новых конструкциях, но я больше не боюсь использовать глубокие цвета», — говорит Марини.«Мы получаем действительно хорошую точность цветопередачи при использовании серых грунтовок, а возможность покрытия в два слоя значительно экономит нам труд».

    Преимущества серого базового покрытия

    Для некоторых глубоких, ярких или прозрачных цветов — около 20 процентов палитры Sherwin-Williams COLOR® — серое базовое покрытие — ваш билет:

    • Достижение точного соответствия цвета за меньшее количество слоев

    • Улучшенный ретушь

    • Улучшенная кожа

    • Глубокие, яркие акцентные цвета, которые выглядят смелее и ярче

    • Более однородный цвет, меньше полос

    • Устранение догадок

    • Экономия времени и денег

    • Повышение удовлетворенности клиентов

    Узнайте больше о грунтовках и других продуктах Sherwin-Williams

  5. Канада

  6. Мексика

  7. Общая информация

    Наши продукты доступны по всей Южной Америке, см. Адреса ниже или свяжитесь с нами по адресу globalsales @ sherwin.com.

  8. Аргентина

    Наши продукты доступны по всей Южной Америке, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  9. Бразилия

    Наши продукты доступны по всей Южной Америке, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  10. Чили

    Наши продукты доступны по всей Южной Америке, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  11. Колумбия

    Наши продукты доступны по всей Южной Америке, см. Адреса ниже или свяжитесь с нами по адресу globalsales @ sherwin.com.

  12. Эквадор

    Наши продукты доступны по всей Южной Америке, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  13. Уругвай

    Наши продукты доступны по всей Южной Америке, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  14. Общая информация

    Наши продукты доступны по всей Центральной Америке, см. Адреса ниже или свяжитесь с нами по адресу globalsales @ sherwin.com.

  15. Коста-Рика

    Наши продукты доступны по всей Центральной Америке, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  16. Сальвадор

    Наши продукты доступны по всей Центральной Америке, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  17. Гватемала

    Наши продукты доступны по всей Центральной Америке, см. Адреса ниже или свяжитесь с нами по адресу globalsales @ sherwin.com.

  18. Гондурас

    Наши продукты доступны по всей Центральной Америке, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  19. Мексика

    Наши продукты доступны по всей Центральной Америке, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  20. Никарагуа

    Наши продукты доступны по всей Центральной Америке, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  21. Панама

    Наши продукты доступны по всей Центральной Америке, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  22. Общая информация

    Наши продукты доступны по всему Карибскому региону, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  23. Багамы

    Наши продукты доступны по всему Карибскому региону, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  24. Bermuda

    Наши продукты доступны по всему Карибскому региону, см. Адреса ниже или свяжитесь с нами по адресу globalsales @ sherwin.com.

  25. Бонайре, Синт-Эстатиус и Саба

    Наши продукты доступны по всему Карибскому региону, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  26. Каймановы острова

    Наши продукты доступны по всему Карибскому региону, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  27. Доминиканская Республика

    Наши продукты доступны по всему Карибскому региону, см. Адреса ниже или свяжитесь с нами по адресу globalsales @ sherwin.com.

  28. Гаити

    Наши продукты доступны по всему Карибскому региону, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  29. Ямайка

    Наши продукты доступны по всему Карибскому региону, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  30. Пуэрто-Рико

    Наши продукты доступны по всему Карибскому региону, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  31. Сент-Китс и Невис

    Наши продукты доступны по всему Карибскому региону, см. Адреса ниже или свяжитесь с нами по адресу globalsales @ sherwin.com.

  32. Острова Теркс и Кайкос

    Наши продукты доступны по всему Карибскому региону, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  33. Виргинские острова (Британские)

    Наши продукты доступны по всему Карибскому региону, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  34. Другие островные страны Карибского бассейна

    Наши продукты доступны по всему Карибскому региону, см. Адреса ниже или свяжитесь с нами по адресу globalsales @ sherwin.com.

  35. Общая информация

    Наши продукты доступны во всем Азиатско-Тихоокеанском регионе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  36. Китай

    Наши продукты доступны во всем Азиатско-Тихоокеанском регионе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  37. Индонезия

    Наши продукты доступны во всем Азиатско-Тихоокеанском регионе, см. Адреса ниже или свяжитесь с нами по адресу globalsales @ sherwin.com.

  38. Япония

    Наши продукты доступны во всем Азиатско-Тихоокеанском регионе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  39. Малайзия

    Наши продукты доступны во всем Азиатско-Тихоокеанском регионе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  40. Сингапур

    Наши продукты доступны во всем Азиатско-Тихоокеанском регионе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  41. Южная Корея

    Наши продукты доступны во всем Азиатско-Тихоокеанском регионе, см. Адреса ниже или свяжитесь с нами по адресу globalsales @ sherwin.com.

  42. Таиланд

    Наши продукты доступны во всем Азиатско-Тихоокеанском регионе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  43. Вьетнам

    Наши продукты доступны во всем Азиатско-Тихоокеанском регионе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  44. Общая информация

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  45. Хорватия

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу globalsales @ sherwin.com.

  46. Кипр

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  47. Чешская Республика

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  48. Дания

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

    General Industrial Coatings


    Industrial Wood Coatings


    Packaging Coatings


    Protective & Marine Coatings


  49. Финляндия

    Наши продукты доступны по всей Европе свяжитесь с нами по адресу globalsales @ sherwin.com.

    Общие промышленные покрытия


    Промышленные покрытия для древесины


    Упаковочные покрытия


    Защитные и морские покрытия


  50. Франция

    Наши продукты доступны по всей Европе или по всей Европе. свяжитесь с нами по адресу [email protected].

  51. Германия

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу globalsales @ sherwin.com.

  52. Венгрия

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  53. Италия

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  54. Литва

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  55. Норвегия

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу globalsales @ sherwin.com.

    General Industrial Coatings


    Industrial Wood Coatings


    Packaging Coatings


    Protective & Marine Coatings


  56. Poland

    Наши местоположения доступны по всей Европе или по всей Европе. свяжитесь с нами по адресу [email protected].

    General Industrial Coatings


    Industrial Wood Coatings


    Packaging Coatings


    Protective & Marine Coatings


  57. Portugal

    Наши продукты доступны по всей Европе. свяжитесь с нами по адресу globalsales @ sherwin.com.

  58. Румыния

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  59. Россия

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  60. Сербия

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  61. Словакия

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу globalsales @ sherwin.com.

  62. Словения

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  63. Испания

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  64. Швеция

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  65. Украина

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу globalsales @ sherwin.com.

  66. Великобритания

    Наши продукты доступны по всей Европе, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  67. Ближний Восток

    Наши продукты доступны по всему Ближнему Востоку, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  68. Австралия

    Наши продукты доступны по всей Австралии, см. Адреса ниже или свяжитесь с нами по адресу [email protected].

  69. сгенерировано: Пт, 29 октября, 01:41:12 UTC 2021

    Хост: tsapp-84d584cf66-6sq9f

    Порт сервера: 443

    Локальный порт: 5443

    Экземпляр: server1

    Создание этой страницы заняло 0 миллисекунд.

    All About Automotive Primer — Типы, информация и советы

    Грунтовка. Это важная часть большинства процессов окраски, и это не исключение в мире автомобильных красок. Красите ли вы свой автомобиль или просто выполняете ремонтные работы, большинство из них порекомендуют отшлифовать, а затем нанести грунтовку, прежде чем переходить к последнему финишному покрытию.

    Итак — что такое праймер?

    В автомобильном мире термин «грунтовка» обычно относится к веществу, похожему на краску, которое обычно наносится на только что отшлифованный металл перед финишным покрытием.Как и краска, различные типы автомобильной грунтовки можно наносить с помощью пистолета-распылителя или кисти, и им дают полностью высохнуть между слоями. Хотя это может показаться добавлением ненужного шага, использование автомобильной грунтовочной краски при повторной окраске кузова автомобиля важно по ряду причин. Некоторые из них обладают хорошими способностями к заполнению, некоторые обеспечивают герметизацию по отношению к элементам, а другие лучше всего работают при использовании в сочетании со вторым типом грунтовки до завершения окончательной окраски.

    Зачем нужна грунтовка?

    Прежде всего, автомобильная грунтовка помогает краске прилипать к голому металлу. Без грунтовки в качестве буфера блестящая металлическая поверхность, старая или новая, не будет хорошо сцепляться с краской. Это приводит к отслаиванию, отслаиванию и, в конечном итоге, к ржавчине, которая в мгновение ока превращает управляемый автомобиль в утиль. Грунтовка для автомобильной краски действует как связующее, помогая краске более прочно прилегать к кузову автомобиля.

    Не менее важно, что грунтовка для автомобильной краски помогает предотвратить повреждение автомобиля ржавчиной и влагой за счет добавления пары дополнительных защитных слоев.Обычно это автомобильная грунтовка-герметик на уретановой или эпоксидной основе.

    Он также может служить в качестве наполнителя для шлифовальных / шлифовальных следов и небольших царапин на кузове вашего автомобиля, устраняя необходимость в шпатлевке или более длительных ремонтных работах, таких как уретановая шпаклевка.

    Как использовать Auto Primer

    Если вы выполняете какие-либо работы с кузовом, ремонтируете или обновляете окраску, в какой-то момент вам понадобится грунтовка. Это особенно актуально, если вы ремонтируете краску своего автомобиля дома и будете шлифовать до голого металла или удалять ржавчину.Большинство типов грунтовок для кузова автомобилей доступны в виде «двухкомпонентных», что означает, что перед использованием необходимо смешать основу грунтовки и активатор. Просто следуйте прилагаемым инструкциям и при необходимости измените. Для других, таких как уретановая грунтовка, может потребоваться смесь до 4 частей, но предоставляются простые инструкции. Третьи поставляются в аэрозольной форме для быстрого и легкого нанесения.

    После того, как вы замешали грунтовочную краску для автомобиля, прежде чем приступить к грунтованию какой-либо части вашего автомобиля, вам нужно сначала убедиться, что вы выполнили несколько подготовительных задач:

    • Полностью удалите ржавчину вручную или шлифованием.

    • Заполните все большие вмятины, вмятины, царапины или вмятины на кузове вашего автомобиля, если вы не выбрали грунтовку, известную своей хорошей сборкой, например полиэфирную грунтовку.

    • Зашлифуйте все пятна или несоответствия перед грунтованием, особенно после шпатлевки или замазки.

    • После завершения шлифовки и другой подготовки необходимо убедиться, что поверхность автомобиля максимально чистая и не содержит частиц, чтобы обеспечить лучший контакт.Быстро вымойте автомобиль и протрите все участки, которые вы могли отшлифовать или стереть, влажной тряпкой. Как всегда, дайте поверхности автомобиля полностью высохнуть перед нанесением любого типа краски или грунтовки.

    • Способ нанесения грунтовки будет зависеть от объема и размера вашего проекта. Если вы просто выполняете небольшие подкраски, нанесение грунтовки вручную определенно подойдет, и вы захотите использовать плавные, ровные мазки, чтобы избежать видимых линий в конце работы по покраске.Если вы собираетесь красить весь автомобиль или перекрашивать большие части автомобиля, лучшим вариантом будет использование краскопульта. Всегда начинайте с чистого пистолета-распылителя и держите под рукой ведро с растворителем, чтобы смочить в нем детали пистолета, как только вы закончите, чтобы предотвратить накопление на вашем оборудовании.

    • После того, как вы нанесли автопраймер, время отверждения будет варьироваться в зависимости от типа, поэтому обязательно ознакомьтесь с этикетками и инструкциями. Мазки и плохое отверждение приводят к плохой окраске, поэтому будьте осторожны, если вы не уверены, что грунтовочный слой полностью высох, и при необходимости дайте дополнительное время.

    • Количество необходимых слоев грунтовки также может быть разным. Для больших площадей и работы всего тела стандартным является два слоя. Это обеспечивает максимальное покрытие и защиту от ржавчины, а также обеспечивает лучшую основу для адгезии краски. Для небольших подкрашиваний руководствуйтесь здравым смыслом. Может потребоваться только одно хорошее пальто.

    Различные виды автомобильной грунтовки

    Тип грунтовки для автомобильной краски, который вы в конечном итоге используете, будет зависеть от требований вашего проекта.Хорошая грунтовочная основа гарантирует долговечную качественную окраску автомобилей и дополнительную защиту от ржавчины. Различные типы автомобильных грунтовок также по-разному выдерживают шлифовку, и в зависимости от вашего проекта вы можете принять это во внимание.

    • Эпоксидная грунтовка — Эпоксидная грунтовка считается хорошей стандартной основой, когда дело доходит до обеспечения сцепления автомобильной краски с металлом и обеспечения качественной окраски. Он разработан специально для предотвращения коррозии, поэтому эпоксидная грунтовка для автомобилей не будет шлифовать так же хорошо, как другие типы, такие как уретановая грунтовка.

    • Urethane Primer Surfacer — Этот тип двухкомпонентного грунтовочного покрытия часто используется в сочетании с любыми шпатлевками или наполнителями, которые вы используете для ремонта, и наносится поверх вторичного грунтовочного покрытия, поскольку он не обеспечивает наилучшую коррозионную стойкость. .

    • Полиэфирная грунтовка — Полиэфирная грунтовка имеет то, что в автомобильном мире известно как отличная «сборка» — она ​​заполняет небольшие царапины и вмятины так же, как шпатлевка или шпатлевка, и обладает самой высокой заполняющей способностью среди всех распыляемых грунтовок.Это делает его идеальным для заполнения дефектов кузова И в то же время для достижения хорошего сцепления с краской. Однако он имеет тенденцию быть немного более хрупким и склонным к растрескиванию, чем уретан или эпоксидная смола после высыхания, поэтому это отличный грунт для небольших ремонтов и работ по заливке, но может быть не лучшим выбором для всего автомобиля.

    • Urethane Sealer — Этот тип грунтовки лучше всего использовать просто как прочный адгезивный слой для приклеивания краски.Уретановый герметик на самом деле не имеет никаких свойств наполнителя, но идеально подходит, когда вы красите автомобиль, который уже находится в приличном состоянии, или вам нужно закрыть большое количество наполнителя или кузова.

    • Acid Etch Primer — Еще одна хорошая грунтовка под автомобильную краску. Грунтовка с кислотным травлением очень похожа на уретановый шпатлеватель в том смысле, что его сильная сторона заключается не столько в защите от коррозии, сколько в обеспечении прочной адгезионной поверхности для краски. Если целью является дополнительная защита от ржавчины, используйте кислотную грунтовку для травления в сочетании с герметиком или антикоррозийным средством.Этот тип грунтовки сохнет намного быстрее, чем другие, поэтому используется при большом количестве кузовных ремонтов в автомагазинах, чтобы сократить время ремонта. Это также устраняет необходимость в каком-либо кондиционере для металла, поэтому его лучше всего наносить непосредственно на голый металл, а затем покрывать вторичной грунтовкой, такой как эпоксидная или уретановая.

    • Эмалевые грунтовки / герметики — Эмалевые грунтовки чрезвычайно экономичны и, как и эпоксидная смола, обеспечивают хорошую основу для приклеивания автомобильной краски.У них хороший уровень коррозионной стойкости.

    • Лаковые грунтовки / герметики — Лаковая грунтовка быстро сохнет и довольно хорошо шлифуется, но может привести к растрескиванию и пузырям в долгосрочной перспективе, поэтому эти типы грунтовок для автомобильных красок лучше всего использовать под антикоррозийным слоем краски для небольших кузовных работ.

    • Moisture Cure Urethane Primer — Эта автомобильная грунтовка отлично подходит как для адгезии краски, так и для защиты от ржавчины при сложных ремонтных работах, когда полное удаление ржавчины невозможно, что делает его отличным универсальным грунтовочным материалом для выполнения двух работ одновременно.Он также быстро затвердевает под воздействием атмосферной влаги, поэтому время отверждения сокращается примерно вдвое.

    Когда использовать автомобильную грунтовку и когда нет необходимости

    Всякий раз, когда вы имеете дело с голым металлом, старым или новым, вам необходимо использовать грунтовку перед тем, как покрыть участок любой автомобильной краской. Если вы делаете небольшой ремонт кузова и вам нужно отшлифовать или стереть пятно, важно защитить эту область и убедиться, что краска приклеится к поверхности, чтобы предотвратить дальнейшие повреждения от ржавчины или отслаивания.

    Единственный случай, когда вам не понадобится грунтовка, — это если вы не открываете какой-либо голый металл. Если вы просто слегка полируете верхний слой краски и не открыли стальные панели вашего автомобиля, то можно отказаться от грунтовки. То же самое и с любыми пластиковыми деталями. Если вы не удаляете краску до голой поверхности, грунтовка не нужна.

    Итак … Какой праймер мне использовать?

    Если вам нужна лучшая универсальная грунтовка, которая обеспечивает небольшую защиту от коррозии и обеспечивает максимальное сцепление с краской, это будет одним из ваших лучших вариантов:

    • Для больших покрасочных работ — в случаях, когда вам нужно перекрасить / отполировать большую площадь поверхности вашего автомобиля, эпоксидная грунтовка обычно будет вашим лучшим вариантом.Это двухкомпонентная грунтовка, поэтому ее легко смешивать, и она обеспечивает оптимальное сочетание адгезии краски, коррозионной стойкости и защиты. Эпоксидный автопраймер можно наносить поверх всего, от наполнителей и стекловолокна до готовой стали или заводской отделки. Время высыхания также быстрое, что делает эту грунтовку отличным универсальным грунтом для автомобилей как для домашних механиков, так и для автомастерских.

    • Для небольших подкрашиваний — полиэфирная грунтовка-шпаклевка идеально подходит для тех небольших ремонтных работ, которые требуют небольшого количества шпатлевки или шпатлевки, так как она имеет отличную «сборку», то есть имеет более толстую сторону и имеет способность заполнять мелкие зазубрины и царапины. и хорошо шлифуется, устраняя необходимость в дополнительной шпатлевке или шпатлевке.Полиэфирная авто грунтовка идеально подходит для выполнения небольших ремонтных работ по кузовному ремонту автомобилей и отлично подходит для точечного ремонта.

    • Для лучшей защиты от ржавчины — в ситуациях, когда ржавчина присутствовала и была отшлифована, или даже когда полное удаление ржавчины невозможно, уретановая грунтовка с отверждением под действием влаги обеспечит лучшую защиту от дальнейшего повреждения ржавчиной. Уретановая авто грунтовка легко шлифуется, быстро сохнет и хорошо сохраняет цвет.

    Выбор типа автомобильной грунтовки не должен быть сложным или запутанным.Начните с определения того, какие потребности наиболее важны при ремонте или перекраске вашего автомобиля — вам понадобится дополнительная защита от ржавчины? Важна ли прочная адгезия краски? Если у вас остались вопросы, Auto Body Toolmart с радостью вам поможет! Свяжитесь с нами, чтобы помочь вам решить проблему с выбором грунтовки или просмотреть весь наш ассортимент автомобильных грунтовок и расходных материалов.

    Инструмент для создания праймеров

    Выбор экзонов / интронов Последовательность мРНК refseq в качестве входных данных шаблона ПЦР требуется для параметров в разделе Справка

    Последовательность мРНК refseq (например, запись последовательности entrez, номер которой начинается с NM_) позволяет программе правильно идентифицировать соответствующую геномную ДНК и, таким образом, находить правильные границы экзона / интрона.

    Размах соединения экзонов Нет предпочтений Праймер должен охватывать соединение экзон-экзон. Праймер не может охватывать соединение экзон-экзон. Справка

    Это контролирует, должен ли праймер охватывать соединение экзона на вашей матрице мРНК. Параметр «Праймер должен охватывать соединение экзон-экзон» предписывает программе возвращать по крайней мере один праймер (в пределах данной пары праймеров), который охватывает соединение экзон-экзон.Это полезно для ограничения амплификации только мРНК. Вы также можете исключить такие праймеры, если хотите амплифицировать мРНК, а также соответствующую геномную ДНК.

    Соответствие соединения экзона

    Мин. 5 минут матча Мин 3 ‘матча Максимум 3 ‘матча

    Минимальное и максимальное количество оснований, которые должны отжигаться с экзонами на 5 ‘или 3’ стороне соединения Справка

    Это определяет минимальное количество оснований, которое праймер должен отжигать с шаблоном со стороны 5 футов (т.е.е., к началу праймера) или 3′-стороне (т.е. к концу праймера) соединения экзон-экзон. Отжиг к обоим экзонам необходим, поскольку он обеспечивает отжиг к области перехода экзон-экзон, но не к каждому экзону в отдельности. Обратите внимание, что этот параметр эффективен только в том случае, если вы выбрали «Праймер должен охватывать соединение экзон-экзон» для параметра «Диапазон соединения экзона».

    Включение интрона Диапазон длины интрона Параметры проверки специфичности пары праймеров Проверка специфичности Режим поиска Автоматически Управляется пользователем Нет руководства пользователя Справка

    Primer-blast пытается найти специфичные для мишени праймеры, помещая кандидатные праймеры в уникальные области матрицы, которые не похожи на другие мишени.Однако в некоторых случаях праймер-взрыв не может определить, является ли последовательность базы данных предполагаемой целью или нет, поэтому руководство пользователя может быть полезным (например, когда ваш шаблон представляет собой полиморфную форму или частичную область записи в поиске database, или когда база данных, такая как nr, содержит повторяющиеся записи вашего шаблона).
    Параметр «Автоматически» запрашивает руководство пользователя только тогда, когда программа не находит достаточного количества уникальных областей шаблона, тогда как параметр «Управляемый пользователем» всегда запрашивает руководство пользователя, если ваш шаблон показывает большое сходство с любыми другими последовательностями базы данных.

    База данных Refseq mRNAR Репрезентативные геномыefseq Геномы для выбранных организмов (только первичная эталонная сборка) nrRefseq РНК (refseq_rna) Пользовательский Справка

    Refseq мРНК:
    & nbsp & nbsp & nbsp Это содержит только мРНК из коллекции эталонных последовательностей NCBI

    репрезентативных геномов Refseq:
    & nbsp & nbsp & nbsp Эта база данных содержит эталонные и репрезентативные геномы NCBI RefSeq по широким группам таксономии, включая эукариоты, бактерии, археи, вирусы и вироиды.Эти геномы являются одними из лучших геномов, доступных в NCBI. Эта база данных содержит минимальную избыточность в представлении генома. Для эукариот включается только один геном для каждого вида (однако, альтернативные локусы эукариотических геномов включены, где это применимо). Для других видов могут быть включены геномы из различных изолятов одного и того же вида. Если применимо, включены геномы митохондрий.

    Refseq РНК:
    & nbsp & nbsp & nbsp Это содержит все записи РНК из коллекции эталонных последовательностей NCBI

    Геномы для выбранных организмов (только первичная эталонная сборка):
    & nbsp & nbsp & nbspЭто полные или почти полные последовательности генома из первичных хромосомных сборок (т.е., без митохондрий или альтернативных локусов) для следующих выбранных организмов:

    & NBSP & NBSP & nbspapis MELLIFERA
    & NBSP & NBSP & nbspbos Taurus
    & NBSP & NBSP & nbspdanio rerio
    & NBSP & NBSP & nbspdog
    & NBSP & NBSP & nbspdrosophila MELANOGASTER
    & NBSP & NBSP & nbspgallus Gallus
    & NBSP & NBSP & nbsphuman
    & NBSP & NBSP & nbspmouse
    & NBSP & NBSP & nbsppan троглодиты
    & NBSP & NBSP & nbsppig
    & NBSP & NBSP & nbsprat

    Хотя последовательности в этой базе данных полностью покрыты базы данных представительные геномов RefSeq, он не содержит альтернативных локусов и, следовательно, имеет даже меньшую избыточность, чем репрезентативная база данных геномов Refseq.Эта база данных рекомендуется, если вас не беспокоит отсутствие альтернативных локусов или последовательностей митохондрий.

    & nbsp & nbsp & nbspВы можете использовать свои собственные последовательности (номер доступа, gi или последовательность FASTA) в качестве базы данных поиска. Размер базы данных ограничен 300 МБ.

    Строгость специфичности праймера Грунтовка должна иметь не менее 123456 всего несовпадений по непреднамеренным целям, в том числе
    по меньшей мере 123456 несоответствия в пределах последнего 1 2 3456 78

    1213141516171819202122 бит / с на 3 ‘конце. Справка

    Для этого требуется, чтобы по крайней мере один праймер (для данной пары праймеров) имел заданное количество несовпадений с непреднамеренными целями. Чем больше несоответствие (особенно в сторону 3 ‘конца) между праймерами и непредусмотренными целями, тем более специфична пара праймеров для вашего шаблона (т.е. будет труднее отжигать с непредусмотренными целями). Однако указание большего значения несовпадения может затруднить поиск таких конкретных праймеров.В таком случае попробуйте уменьшить значение рассогласования.

    Игнорировать цели, у которых есть 123456789 или более не соответствует грунтовке. Справка

    Это еще один параметр, который можно использовать для регулировки строгости специфичности праймера. Если общее количество несовпадений между мишенью и по крайней мере одним праймером (для данной пары праймеров) равно или превышает указанное число (независимо от местоположений несоответствия), то любые такие мишени будут игнорироваться для проверки специфичности праймера.Например, если вас интересуют только цели, которые идеально соответствуют праймерам, вы можете установить значение 1. Вы также можете уменьшить значение E (см. Дополнительные параметры) в таком случае, чтобы ускорить поиск, как высокое значение E по умолчанию. не требуется для обнаружения мишеней с небольшим количеством несовпадений с праймерами.
    Кроме того, эта программа имеет предел обнаружения мишеней, которые слишком отличаются от праймеров … она обнаруживает мишени, которые имеют до 35% несовпадений с последовательностями праймеров (т.е. всего 7 несовпадений для 20-мерного элемента).
    Вам может потребоваться выбрать более чувствительные параметры взрыва (в дополнительных параметрах), если вы хотите обнаруживать цели с большим количеством несовпадений, чем по умолчанию.

    Максимальный размер целевого ампликона Разрешить варианты стыковки

    В чем разница между праймером и увлажняющим кремом?

    Принято считать, что праймер и увлажняющий крем — это одно и то же или что одно может заменить другое.Но это не правда! Оба этих продукта имеют разные цели для вашей кожи.

    Этот пост содержит партнерские ссылки. Прочтите полное раскрытие здесь.

    В чем разница между праймером и увлажняющим кремом?

    Праймер (например, этот легкий бальзам для лица ) образует барьер между вашей кожей и средствами для макияжа. Это гарантирует, что вы получите ровную основу для гладкого нанесения тонального крема или пудры, не оставляя пятен на лице.

    Увлажняющий крем вернет влагу в сухие участки, например, вокруг носа, щек и лба, где морщины со временем проявляются первыми.

    Итак, праймер — это макияж, а увлажняющий крем — уход за кожей. Хотя некоторые люди могут полагать, что их можно использовать как взаимозаменяемые, это совсем не так! Увлажняющий крем увлажняет нашу кожу и предотвращает ее высыхание, а праймер помогает создать ровную поверхность, поэтому при нанесении тонального крема или тонированных увлажняющих кремов вы не получите пятнистого покрытия.

    Праймер поможет вашей коже дольше выглядеть идеально. Многие люди не знают, что делают праймеры и зачем они им нужны. По правде говоря, такие праймеры, как этот легкий бальзам для лица , могут помочь вам получить максимум удовольствия от макияжа и сохранить его свежий вид в течение всего дня. Существует множество формул праймеров в зависимости от вашего типа кожи и внешнего вида, который вы ищете.

    Посмотреть список лучших увлажняющих средств на сегодняшний день

    Мы создали это руководство по грунтовке , чтобы дать вам ответы на все вопросы, от выбора лучшего варианта до его правильного применения.

    Увлажняющие средства помогают предотвратить сухость и восполняют влажность вашей кожи. После нанесения увлажняющего крема ваше лицо станет мягким и эластичным, без сухих пятен и трещин.

    Увлажняющий крем — это НЕ просто косметический продукт. Это очень важный этап в повседневном уходе за кожей. Сегодня на рынке доступно множество типов увлажняющих средств, таких как гели, лосьоны, сыворотки, кремы и масла, в зависимости от того, что вас беспокоит. Увлажняющие средства предназначены для разных целей, поэтому вам нужно выбрать тот, который лучше всего подходит для вашего типа кожи.

    Если у вас сухая кожа, вы можете использовать богатый увлажняющий крем, такой как этот увлажняющий крем с такими ингредиентами, как масло ши, или вы можете попробовать масло для лица, такое как это масло для терапии кожи .

    Для жирной кожи используйте легкую гелевую формулу, такую ​​как этот увлажняющий крем Hydro Boost , или крем без масла, например дневной увлажняющий крем . Старайтесь избегать жирных кремов, так как они могут сделать вашу кожу жирной. Выберите некомедогенную формулу, которая не забивает поры и не вызывает высыпаний.

    Если у вас комбинированный тип кожи, выберите легкую формулу, такую ​​как этот увлажняющий крем для лица с такими ингредиентами, как глицерин или гиалуроновая кислота. Вы можете использовать два разных увлажняющих крема в зависимости от потребностей вашей кожи. Для жирных областей попробуйте легкую формулу, которая предотвращает избыточное выделение масла, и используйте богатую формулу для сухих областей.

    Сначала праймер или увлажняющий крем?

    Вам всегда интересно, что на первом месте, праймер или увлажняющий крем? Праймер — это первый шаг в нанесении макияжа, и его следует наносить после увлажняющего крема.Нанесение увлажняющего крема сначала увлажняет кожу и подготавливает ее к нанесению макияжа.

    Первый шаг в любой косметической программе — убедиться, что ваша кожа чистая и хорошо подготовлена ​​к нанесению макияжа. Если у вас сухая кожа, трудно получить идеальное полотно для нанесения тонального крема без предварительного увлажнения кожи.

    Большинство людей не осознают, что нанесение праймера ДО увлажняющего крема может ухудшить внешний вид макияжа. При нанесении макияжа важно соблюдать правильный порядок.Если вы нанесете праймер перед увлажняющим кремом, ваш тональный крем будет труднее держаться и создавать неровную поверхность.

    Тональный крем плохо ложится на сухую кожу. Он подчеркнет сухие участки, которые могут сделать вас старше. Всегда сначала используйте увлажняющий крем, чтобы восстановить баланс влаги и выровнять поверхность кожи. Таким образом, макияж будет хорошо ложиться поверх него, а остальная часть вашей процедуры макияжа пройдет гладко!

    Каждая женщина хочет выглядеть лучше всех каждый день.Ключ в том, чтобы правильно расставить косметические продукты, чтобы вы могли сразу же начать выглядеть и чувствовать себя великолепно!

    Мы собираемся разделить лучшие процедуры для кожи на 3 этапа:

    1. Очистка

    Лучший способ начать свой распорядок — смыть всю грязь. Используйте мягкое очищающее средство, чтобы удалить все загрязнения. Смочите кожу и аккуратно помассируйте очищающим средством. Не трите продукт со скрабом или втиранием, так как это может вызвать раздражение кожи.

    2. расслоение

    Отшелушивание помогает избавиться от омертвевших клеток кожи. Он также позволяет очистить поры, особенно если у вас склонная к акне кожа. Не всем нужно отшелушивать ежедневно, это зависит от вашего типа кожи. Для жирной кожи рекомендуется отшелушивать два-три раза в неделю, а для нормальной или комбинированной кожи одного раза в неделю более чем достаточно. Обязательно найдите мягкое отшелушивающее средство, а не жесткое, которое может вызвать раздражение.

    3 . Увлажняющий

    Увлажнение — третий шаг после отшелушивания.Выбор лучшего увлажняющего крема зависит от вашего типа кожи. Если у вас жирная кожа, попробуйте нежную гелевую формулу, которая не делает вашу кожу жирной или жирной. Для сухой кожи лучше всего подойдут насыщенные кремы. Масла для лица также являются отличной альтернативой, особенно для очень сухой кожи.

    Как долго ждать между увлажняющим кремом и праймером?

    Для получения лучших результатов сначала нанесите тонкий слой увлажняющего крема, затем подождите 30-60 секунд перед нанесением праймера или любых других продуктов.Если у вас сухая кожа, возможно, вы используете насыщенный увлажняющий крем, поэтому более длительное ожидание позволяет увлажняющему крему впитаться в вашу кожу, что сделает ее более мягкой. Если вы нанесете праймер сразу же, он может плохо ложиться на вашу кожу, и это может привести к крошению и отделению основы.

    Хорошо увлажненная кожа — идеальное полотно для нанесения макияжа. Это помогает вашей тональной основе легче растушеваться. Имейте в виду, что эти лишние несколько минут того стоят, чтобы кожа выглядела безупречно!

    Выберите грунтовку, совместимую с вашим основанием.Использование грунтовки на основе силикона и основы на водной основе может не дать наилучших результатов. это может привести к разделению вашего фундамента. Если вы когда-нибудь задумывались, почему грунтовка ухудшает внешний вид вашей основы, это может быть из-за их формулы. Всегда выбирайте праймер и тональный крем с одними и теми же основными ингредиентами.

    Увлажняющая праймер против увлажняющего крема Праймеры

    бывают разных формул, и одним из лучших вариантов для сухой кожи является увлажняющий праймер .Это увлажняющий крем и праймер, который помогает увлажнить кожу при подготовке к нанесению макияжа.

    Если вы ищете дополнительную влагу в дополнение к преимуществам праймера для подготовки макияжа, вы можете попробовать увлажняющий праймер . Этот продукт содержит множество полезных ингредиентов, которые помогают удерживать влагу, чтобы ваше лицо было свежим в течение всего дня.

    Это универсальный продукт, который хорошо сочетается с макияжем. Он имеет легкую текстуру, что позволяет легко наносить продукт, не чувствуя жирности на лице!

    Увлажняющий праймер — это простой способ вернуть коже влагу, уменьшая появление тонких линий и морщин.

    Однако этот праймер не предназначен для замены увлажняющего крема. Это всего лишь дополнительный шаг к увлажнению этих сухих пятен на лице!

    Можно ли использовать увлажняющий крем в качестве праймера?

    Увлажняющий крем и праймер — это два разных продукта, поэтому использование увлажняющего крема в качестве праймера не даст такого же эффекта, как настоящая праймер.

    В зависимости от типа кожи вы можете не использовать праймер и использовать увлажняющий крем.

    Если у вас неровная текстура или большие поры, вам понадобится минимизирующий поры или разглаживающий грунт, подобный этому доступному по цене.Это помогает подготовить кожу, чтобы тональный крем красиво ложился сверху. Еще нам нравится этот безмасляный грунт ! Он имеет прозрачную гелевую формулу с витаминами А и Е для защиты вашей кожи.

    Людям с жирной кожей нужен матирующий праймер , такой как этот водостойкий, чтобы контролировать жир.

    Все эти проблемы невозможно решить с помощью увлажняющего крема. Однако, если ваш макияж хорошо ложится на кожу без каких-либо проблем, праймер вам, вероятно, не понадобится. Достаточно использовать легкий увлажняющий крем для подготовки кожи к нанесению тонального крема.

    Заключительные мысли

    Разница между увлажняющим кремом и праймером заключается в том, что увлажняющий крем — это последний шаг в уходе за кожей перед тем, как солнцезащитный крем и праймер станут первым шагом в вашей рутине макияжа.

    Использование праймера зависит от типа вашей кожи. Если макияж хорошо ложится на лицо без каких-либо проблем, праймер вам не понадобится. Достаточно использовать увлажняющий крем для увлажнения и питания кожи. Делает лицо гладким и подготавливает его к макияжу.

    Однако, если у вас большие поры, текстура кожи, сухая кожа или жирная кожа, использование праймера может помочь сгладить кожу, чтобы макияж хорошо ложился на нее.

    Лучший способ начать свой распорядок — смыть грязь и загрязнения, а затем увлажнить кожу, чтобы избежать высыхания пятен на коже, которые могут ужасно выглядеть под тональным кремом.

    Похожие сообщения

    Лучшие основы на водной основе

    Как предотвратить расслоение макияжа

    Следует наносить солнцезащитный крем до или после праймера?

    Грунтовка ухудшает внешний вид фундамента?

    Что такое праймер для макияжа?

    Primer VS Увлажняющий крем

    Праймер для домашнего макияжа

    Собираетесь ли вы раскрыть полностью накрашенное лицо, готовое для крупным планом, или просто собираетесь выйти с тонированным солнцезащитным кремом и минимумом макияжа, нанесение слоя праймера для лица может быть большой плюс.Многие люди отказываются от этого шага, потому что они никогда не пробовали или не знали, что им нужно. Другие могли попробовать, но соединили грунтовку с фундаментом, который не подошел. Старая поговорка о том, что вода и масло не смешиваются, применима и к макияжу. Однако, если все сделать правильно, это может поднять вашу игру красоты на новый уровень.

    Мы часто думаем о фундаменте как о первом шаге, потому что, здравствуйте, это называется фундаментом, и слова должны указывать нам порядок действий, верно? Что ж, если мы думаем о строительстве дома или о добавлении цвета на холст, перед этим «первым» шагом есть несколько шагов.На самом деле их может быть несколько. Перед заливкой бетонного фундамента дома необходимо провести необходимые земляные работы, провести гидроизоляцию и засыпать. И нужно ли мне сейчас гуглить эти шаги по строительству дома? Да, да. Но имеет смысл подготовить поверхность, чтобы получить наилучшие результаты, и это справедливо и для лица. Важно сначала очистить и отшелушивать. Затем нанесение праймера для лица обеспечивает гладкую поверхность, на которой вы можете нарисовать свой шедевр.

    Primer помогает скрыть вид больших пор, заполняет мелкие морщинки и впитывает масло. Если у вас более жирная кожа, грунтовка обеспечит основу для приклеивания основы, которая продержится намного дольше, чем без нее. Благодаря этому макияж остается свежим и не кажется, будто он медленно соскальзывает с лица.

    Большинство праймеров, которые вы можете купить, содержат силикон и создают барьер между вашей основой и лицом. Это прекрасное решение для многих, но иногда встречаются люди, страдающие аллергией или просто предпочитающие другие ингредиенты, служащие той же цели.Если вы еще не выбрали идеальный праймер для себя и ищете небольшой самодельный макияж с низким уровнем риска, попробуйте посмотреть, подходит ли вам один из этих вариантов праймера , приведенный ниже, и в конечном итоге сделайте свои собственные продукты.

    Бонус: когда использовать солнцезащитный крем в 2020 году

    1. Грунтовка-распылитель с глицерином

    Поскольку некоторые из вас могут даже не дойти до конца этого поста, мы решили, что сначала расскажем о простой аэрозольной грунтовке! Кроме того, нет ничего постыдного в том, чтобы не прокручивать до конца — может быть, вы просто хотите заняться делом и сделать это своими руками, или, возможно, вам нужно вернуться к перееданию всех фильмов о Звездных войнах, когда-либо созданных с вашими детьми.Это тоже отличное использование времени. Никто не судит — мы здесь, чтобы помочь!

    Все, что требуется для этого спрея, — это небольшая бутылочка с распылителем, фильтрованная вода и глицерин. Не беспокойтесь о бутылочке — вы можете купить ее практически в любой аптеке или использовать другую из своей косметички. Глицерин является увлажняющим средством, что означает, что он помогает коже удерживать воду. Если просто распылить на лицо обычную воду, она в конечном итоге испарится, и ваша кожа станет немного суше.Добавление глицерина удерживает часть этой необходимой влаги. Используйте примерно 10 частей воды на одну часть глицерина, и вуаля! У вас есть простое решение для увлажнения кожи и придания ей слегка липкой текстуры, благодаря которой макияж намного лучше держится.

    Имейте в виду, что вы не хотите, чтобы эта смесь лежала слишком долго, потому что она может быть кормом для бактерий. Но если вы будете переделывать его каждые несколько дней, все будет в порядке. И если мысль об этом заставляет вас нервничать или вы не очень последовательны в отслеживании того, какой сегодня день, то вы всегда можете положить каплю глицерина в ладонь, намазать ее водой и похлопать по себе. лицо.Таким образом, вы можете не беспокоиться и при этом оставаться увлажненными. Кроме того, даже небольшое количество глицерина придаст вам слегка липкую текстуру, которая поможет вашему макияжу держаться дольше.

    Считай, что твоя мордашка загрунтована своими руками!

    Бонус: как использовать увлажняющий спрей

    2. Праймер на основе алоэ вера

    Гель алоэ вера — отличный ингредиент для домашнего праймера DIY primer , потому что это не только то, что у вас может быть под рукой, но и лучший друг для вашей кожи.Независимо от того, соскребаете ли вы его с растения самостоятельно или покупаете в магазине, важно, чтобы на вашей коже были эти полезные вещества. Гель обладает противогрибковыми и противовоспалительными свойствами и способствует регенерации клеток. Это сохраняет кожу защищенной и молодой. Он содержит витамины А и С, поэтому также питает кожу. В конечном итоге гель алоэ вера действует как клей, который помогает клеткам кожи слипаться, создавая эффект сглаживания поверхности. Для достижения консистенции, необходимой для превращения этого геля в самодельный продукт для лица, требуется всего пара других ингредиентов.

    Для этой смеси, сделанной своими руками, вам понадобится одна часть геля алоэ вера на одну часть увлажняющего крема. Если ваш увлажняющий крем уже содержит солнцезащитный крем, вам не нужно его добавлять, но если его нет, вы можете решить, хотите ли вы добавить и его. Просто помните, что это еще один способ защитить вашу кожу от нежелательных солнечных лучей. Затем все, что вам нужно сделать, это добавить небольшое количество жидкого слоя, чтобы вы могли легко оценить степень покрытия по мере нанесения. Если ваша кожа не сухая, вы также можете добавить несколько щепоток рассыпчатой ​​пудры, чтобы получить более густую шелковистую консистенцию.

    Если вы не пользуетесь большим количеством макияжа, это может быть все, что вам нужно перед тем, как начать свой день. Но если нет, то у вас есть прекрасный базовый слой, на котором можно творить чудеса.

    Если какой-либо из вышеперечисленных шагов был непонятен или вы просто научились лучше, наблюдая, вот короткое видео, сделанное своими руками.

    3. Алоэ Вера снова наносит удар

    Честно говоря, многие используют Алоэ Вера, потому что это просто потрясающе для вашего лица! Как и в рецепте выше, вам понадобится алоэ вера, увлажняющий крем и рассыпчатая пудра, но для этого также требуется гамамелис.Итак, давайте приступим к нашему хвалебному описанию преимуществ Hamamelis virginiana , более известного как гамамелис.

    Скорее всего, вы встречали бутылку и извлекли пользу из ее способности успокаивать и тонизировать кожу. Но знаете ли вы, что он содержит антиоксиданты, которые помогают предотвратить воспаление? Ведьма Хейзел также может нейтрализовать свободные радикалы — соединения, которые накапливаются в вашем теле и вызывают болезни. Уменьшает покраснение от травм или раздражения при местном нанесении на кожу.Итак, если вы склонны к высыпаниям и у вас жирная кожа или сухая кожа , добавление гамамелиса — отличный способ избавиться от этого. Это также просто твердый продукт, который можно носить с собой при других раздражениях кожи или протирать ватным тампоном, чтобы очистить и освежить лицо.

    Просто смешайте в равных частях гель и увлажняющий крем (дополнительные очки, если он содержит солнцезащитный крем), а затем добавьте несколько капель гамамелиса. Точное количество капель будет зависеть от того, сколько вы планируете сделать, и от желаемой консистенции.Затем вы можете просто размазать его чистыми пальцами. Если вы свистите, пока ждете — реплика «Whistle While Your Work» от Белоснежки (и семи гномов) — то, прежде чем вы это узнаете, ваш праймер застынет. А это значит, что все готово!

    4. Праймер для жирной кожи Calamine Cure

    Может быть, прямо сейчас вы спрашиваете: «Но у меня нет ветряной оспы, так зачем мне использовать лосьон с каламином?» Что ж, вы к чему-то пришли, создав эту ассоциацию, но лосьон с каламином можно использовать не только для снятия зуда и раздражения на коже.Иногда его используют для точечной обработки прыщей из-за его сушильных свойств и способности впитывать излишки масла. Что ж, я уверен, вы уже догадались, что эти свойства работают и для грунтовки, особенно когда вам нужна небольшая помощь в управлении порами, которые действуют как нефтяные скважины.

    Это тот самый праймер для макияжа в списке, на который вам нужно сначала нанести увлажняющий крем. Поскольку лосьон с каламином может быть довольно сушильным, вам нужно немного напоить кожу, прежде чем закрывать ее от мира.После того, как вы нанесете его, вы можете налить немного лосьона с каламином на колпачок или на чистую поверхность, на которую вы будете макать кисть для рисования. Кистью нанесите тонкий слой на все лицо. (Если вы никогда раньше не наносили лосьон с каламином на кожу, вам следует провести тест на пластырь, чтобы убедиться, что у вас нет аллергии. скин.)

    Вы заметите, что он создает на вашей коже легкий меловой слой, который является идеальной палитрой для нанесения ваших любимых румян, оттенков и т. Д.Это определенно не тот праймер, который стоит использовать, если вы собираетесь нанести легкий слой макияжа или планируете полностью отказаться от тонального крема. Это идеальный праймер для полноценного макияжа, который нужно держать с утра до вечера. Теперь вы можете уверенно расхаживать свои вещи в течение всего дня.

    5. Праймер Island-Perfect

    Если вы чем-то похожи на меня, ваш разум переносит вас на тропический остров, где вы держите стакан большой девочки с крошечным зонтиком, как только ваш сниффер уловит запах сладкого кокоса.Кокосовое масло — отличный натуральный увлажняющий крем, и он является звездой этого рецепта. Он содержит жирные кислоты, которые питают и увлажняют кожу. Витамин Е, содержащийся в кокосе, также делает кожу очень гладкой. Однако не все любят кокосы, поэтому, если вы этого не сделаете, вы можете выбрать другое масло или увлажняющий продукт, чтобы добавить к этому праймеру. Подойдет немного масла авокадо или вашего любимого увлажняющего крема.

    Для этого рецепта макияжа «Сделай сам» смешайте ⅓ чашки алоэ вера с чайной ложкой кокосового масла и пару щепоток минеральной пудры для макияжа, которая, как вы точно уверены, у вас где-то в ящике.После того, как он будет тщательно перемешан, вы можете нанести его пальцами или чистой кистью для макияжа. Он идеально подходит для любого типа кожи и особенно хорошо увлажняет более сухую или стареющую кожу. Вы можете украсить себя куклой на вечер или просто добавить BB-крем и отправиться в путь. Не стесняйтесь делиться этим секретом макияжа по кокосовому телеграфу, так как нет необходимости держать хорошие новости при себе!

    Бонус: как использовать гель для век

    Праймер для домашнего макияжа «Вот как вы делаете»!

    Ну вот и закончил ваш праймер для рукоделия .Хорошо, что многие из этих вещей могут уже быть в вашем доме прямо сейчас. В противном случае их довольно легко найти в аптеке или в Интернете. Каждый из вышеперечисленных вариантов творит чудеса для некоторых типов кожи, но обязательно обратите внимание на уникальные потребности своей кожи и соответствующим образом скорректируйте рецепты.

    Не все любят заниматься своими делами, и это тоже хорошо.

    Некоторые люди потратили много времени на совершенствование формул, чтобы получить идеальный микс для макияжа.Есть множество причин доверять этому эксперту, особенно если у вас есть доступные варианты, которые просто потрясающие, например, Retexturizing Face Primer от Вивиан Вудард. Этот восстанавливающий текстуру праймер для лица творит чудеса с любым типом кожи. Оно легкое, но богато витаминами А, Е и С, которые питают и исцеляют кожу, делая ее шелковистой и гладкой. Как и все продукты для макияжа Viviane Woodard, это веганский продукт без жестокого обращения. Так что, если у вас нет желания заниматься своими руками, расслабьтесь и позвольте Вивиан Вудард Д.I. для Y.

    Более 60 лет Вивиан Вудард представляет «Чистоту ухода за кожей». Мы являемся ведущим косметическим брендом по уходу за кожей на водной основе и пропагандируем важность хорошего увлажнения кожи. Подпишитесь на нас в Facebook , Instagram, Twitter и Pinterest , чтобы получить советы по уходу за кожей, скидки на продукты и многое другое.

    Что такое грунтовка для дерева? — Лучшая грунтовка для дерева


    KILZ Premium Primer

    Masterchem Industries амазонка.ком

    21,17 долл. США

    Если вы собираетесь начать свой собственный проект DIY, покрасив что-нибудь деревянное, остановитесь прямо здесь — вы захотите использовать грунтовку для дерева, и вот почему: это сделает вашу покраску намного более гладкой, чем если бы вы этого не делали. используйте один, это придаст ему более профессиональный вид, защитит древесину и улучшит качество краски. Итак, что именно нужно знать о грунтовке для дерева перед ее покупкой? Вот основная информация.

    Что такое грунтовка для дерева?

    Грунтовка для дерева — это грунтовка подготовительного покрытия, наносимого на древесину, в частности, перед нанесением на нее краски.Использование грунтовки для дерева увеличивает долговечность лакокрасочного покрытия, обеспечивает лучшую адгезию краски к поверхности и помогает защитить окрашиваемую древесину.

    Когда следует использовать грунтовку для дерева?

    Все зависит от породы дерева, которую вы будете красить. Согласно Lowe’s, когда вы красите новую древесину, которая не окрашена, вы должны использовать высококачественную латексную грунтовку или грунтовку на масляной основе. Если ваша новая древесина окрашена или окрашена, вам понадобится грунтовка, препятствующая образованию пятен.Для более старой, состаренной древесины требуется высококачественная латексная или масляная грунтовка.

    Как использовать грунтовку для дерева?

    Сначала необходимо тщательно очистить дерево, которое вы будете красить, а затем отшлифовать поверхность. После шлифовки удалите всю пыль, скопившуюся во время процесса. (Вымойте поверхность влажной тряпкой, чтобы убедиться, что на ней нет твердых частиц.) Затем нанесите грунтовку для дерева. Вы должны нанести два слоя грунтовки, которая в конечном итоге станет немного меловой.

    Полуглянцевая краска

    BEHR homedepot.ком

    35,98 $

    Набор малярных валиков

    Выбор Бейтса amazon.com

    15,99 долл. США

    Этот контент импортирован из {embed-name}. Вы можете найти тот же контент в другом формате или найти дополнительную информацию на их веб-сайте.

    Подписывайтесь на House Beautiful в Instagram.

    Этот контент создается и поддерживается третьей стороной и импортируется на эту страницу, чтобы помочь пользователям указать свои адреса электронной почты. Вы можете найти больше информации об этом и подобном контенте на сайте piano.io.


Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *